apraga/org - Change K54WC2QNEXHVKE2YFU3DOCEUYZTGLINXBRLSHQX4BNDADWUMJGFAC

Bisonex : data source + first results NA12878

Created by Alexis Praga on April 4, 2023

K54WC2QNEXHVKE2YFU3DOCEUYZTGLINXBRLSHQX4BNDADWUMJGFAC

Dependencies

In channels

main

Change contents

Replacement in projects/bisonex.org at line 2 [3.35]

B:BD[2.9377] → [2.9377:17569]

ategy that producing different length of reads (all BGI platforms
 were 100 base pair read length while all Illumina platforms were 150 base pair
 read length). The read length effects, as a key factor between two platforms,
 would bring alignment bias and error which are higher for short reads and
 ultimately affect the variants calling especially the INDELs identification
#+end_quote
*** Débugger variant calling (haplotypecaller)
https://gatk.broadinstitute.org/hc/en-us/articles/360043491652-When-HaplotypeCaller-and-Mutect2-do-not-call-an-expected-variant
https://gatk.broadinstitute.org/hc/en-us/articles/360035891111-Expected-variant-at-a-specific-site-was-not-called
*** Hap.py
Format de sortie :
#+begin_src r
vcf_field_names(vcf, tag = "FORMAT")
#+end_src
#+RESULTS:
: FORMAT BD    1      String  Decision for call (TP/FP/FN/N)
: FORMAT BK    1      String  Sub-type for decision (match/mismatch type)
: FORMAT BVT   1      String  High-level variant type (SNP|INDEL).
: FORMAT BLT   1      String  High-level location type (het|homref|hetalt|homa
am = genotype mismatch
lm = allele/haplotype mismatch
. = non vu
**** On vérifie que am = genotype mismatch
référence  = T/T
high-confidence = T/C
notre = C/C
#+begin_src sh
bcftools filter -i 'POS=19196584'  /Work/Groups/bisonex/data/giab/GRCh38/HG001_GRCh38_1_22_v4.2.1_benchmark.vcf.gz | grep -v '#'
bcftools filter -i 'POS=19196584'  ../out/NA12878_NIST7035-dbsnp/variantCalling/haplotypecaller/NA12878_NIST.vcf.gz | grep -v '#'
#+end_src
#+RESULTS:
: NC_000022.11    19196584        .       T       C       50      PASS    platforms=5;platformnames=Illumina,PacBio,10X,Ion,Solid;datasets=5;datasetnames=HiSeqPE300x,CCS15kb_20kb,10XChromiumLR,IonExome,SolidSE75bp;callsets=7;callsetnames=HiSeqPE300xGATK,CCS15kb_20kbDV,CCS15kb_20kbGATK4,HiSeqPE300xfreebayes,10XLRGATK,IonExomeTVC,SolidSE75GATKHC;datasetsmissingcall=CGnormal;callable=CS_HiSeqPE300xGATK_callable,CS_CCS15kb_20kbDV_callable,CS_10XLRGATK_callable,CS_CCS15kb_20kbGATK4_callable,CS_HiSeqPE300xfreebayes_callable GT:PS:DP:ADALL:AD:GQ    0/1:.:781:109,123:138,150:348
: NC_000022.11    19196584        rs1061325       T       C       59.32   PASS    AC=2;AF=1;AN=2;DB;DP=2;ExcessHet=0;FS=0;MLEAC=1;MLEAF=0.5;MQ=60;QD=29.66;SOR=2.303      GT:AD:DP:GQ:PL  1/1:0,2:2:6:71,6,0
**** On vérifie que lm = allele/haplotype mismatch
référence  = CAA/CAA
high-confidence = CA/CA
notre = C/CA
#+begin_src sh
 bcftools filter -i 'POS=31277416'  /Work/Groups/bisonex/data/giab/GRCh38/HG001_GRCh38_1_22_v4.2.1_benchmark.vcf.gz | grep -v '#'
 bcftools filter -i 'POS=31277416'  ../out/NA12878_NIST7035-dbsnp/variantCalling/haplotypecaller/NA12878_NIST.vcf.gz | grep -v '#'
#+end_src
#+RESULTS:
: NC_000022.11    31277416        .       CA      C       50      PASS    platforms=3;platformnames=Illumina,PacBio,10X;datasets=3;datasetnames=HiSeqPE300x,CCS15kb_20kb,10XChromiumLR;callsets=4;callsetnames=HiSeqPE300xGATK,CCS15kb_20kbDV,10XLRGATK,HiSeqPE300xfreebayes;datasetsmissingcall=CCS15kb_20kb,CGnormal,IonExome,SolidSE75bp;callable=CS_HiSeqPE300xGATK_callable;difficultregion=GRCh38_AllHomopolymers_gt6bp_imperfectgt10bp_slop5,GRCh38_SimpleRepeat_imperfecthomopolgt10_slop5  GT:PS:DP:ADALL:AD:GQ    1/1:.:465:16,229:0,190:129
: NC_000022.11    31277416        rs57244615      CAA     C,CA    389.02  PASS    AC=1,1;AF=0.5,0.5;AN=2;BaseQRankSum=0.37;DB;DP=37;ExcessHet=0;FS=0;MLEAC=1,1;MLEAF=0.5,0.5;MQ=60;MQRankSum=0;QD=13.41;ReadPosRankSum=-0.651;SOR=0.572    GT:AD:DP:GQ:PL  1/2:5,10,14:29:64:406,202,313,64,0,88
* Idées
** Validation analytique
mail Yannis : données patients +/- simulées
*** Utiliser données GCAT et uploader le notre ?
https://www.nature.com/articles/ncomms7275
*** [#A] Variant calling : Genome in a bottle : NA12878 + autres
Résumé : https://www.nist.gov/programs-projects/genome-bottle
Manuscript : https://www.nature.com/articles/s41587-019-0054-x.epdf?author_access_token=E_1bL0MtBBwZr91xEsy6B9RgN0jAjWel9jnR3ZoTv0OLNnFBR7rUIZNDXq0DIKdg3w6KhBF8Rz2RWQFFc0St45kC6CZs3cDYc87HNHovbWSOubJHDa9CeJV-pN0BW_mQ0n7cM13KF2JRr_wAAn524w%3D%3D
Article comparant les variant calling : https://www.biorxiv.org/content/10.1101/2020.12.11.422022v1.full.pdf
**** KILL Tester le séquencage aussi
CLOSED: [2023-01-30 lun. 18:30]
Depuis un fastq correspondant à Illumina  https://github.com/genome-in-a-bottle/giab_data_indexes
   puis on compare le VCF avec les "high confidence"
On séquence directement NA12878 -> inutile pour le pipeline seul
**** TODO Tester seul la partie bioinformatique
   Tout résumé ici : https://www.nist.gov/programs-projects/genome-bottle
- methode https://ftp-trace.ncbi.nlm.nih.gov/ReferenceSamples/giab/data/NA12878/analysis/Illumina_PlatinumGenomes_NA12877_NA12878_09162015/IlluminaPlatinumGenomes-user-guide.pdf
- vcf
     https://ftp-trace.ncbi.nlm.nih.gov/ReferenceSamples/giab/release/NA12878_HG001/latest/GRCh38/
NB: à quoi correspond https://ftp-trace.ncbi.nlm.nih.gov/ReferenceSamples/giab/data/NA12878/analysis/Illumina_PlatinumGenomes_NA12877_NA12878_09162015/hg38/2.0.1/NA12878/ ??
   Article comparant les variant calling : https://www.biorxiv.org/content/10.1101/2020.12.11.422022v1.full.pdf
   Article pour vcfeval : https://www.nature.com/articles/s41587-019-0054-x
   La version 4 ajoute 273 gènes "clinically relevant" https://www.biorxiv.org/content/10.1101/2021.06.07.444885v3.full.pdf
   Ajout des zones "difficiles"
   https://www.biorxiv.org/content/10.1101/2020.07.24.212712v5.full.pdf
*** [#B] Pipeline : générer patient avec tous les variants retrouvés à Centogene
Comparaison de génération ADN (2019)
https://academic.oup.com/bfg/article/19/1/49/5680294
**** SimuSCop
https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-020-03665-5
https://github.com/qasimyu/simuscop
1. Crééer un modèle depuis bam + vcf : Setoprofile
2. Génerer données NGS
** Annotation :
*** Comparaison vep / snpeff et annovar
* Changement nouvelle version
- Dernière version du génome (la version "prête à l'emploi" est seulement GRCh38 sans les version patchées)
* Notes
** Nextflow
*** afficher les résultats d'un process/workflow
#+begin_src
lol.out.view()
#+end_src
Attention, ne fonctionne pas si plusieurs sortie:
#+begin_src
lol.out[0].view()
#+end_src
ou si /a/ est le nom de la sortie
#+begin_src
lol.out.a.view()
#+end_src
** Quelle version du génome ?
Il y a 2 notations pour les chrosome: Refseq (NC_0001) ou chr1, chr2...
dbSNP utilise Refseq
pour le fasta, 2 solutions
- refseq : "https://ftp.ncbi.nlm.nih.gov/refseq/H_sapiens/annotation/${genome}_latest/refseq_identifiers/${fna}.gz"
  -> nécessite d'indexer le fichier (long !)
- chromosome https://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/001/405/GCA_000001405.15_GRCh38/seqs_for_alignment_pipelines.ucsc_ids/
  -> nécessite d'annoter les chromosomes pour corriger (avec le fichier gff)
  On utilise la version chromosome donc on annote dbSNP (à faire)
** Performances
Ordinateur de Carine (WSL2) : 4h dont 1h15 alignement (parallélisé) et 1h15 haplotypecaller (séquentiel)
** Chromosomes NC, NT, NW
Correspondance :
https://genome.ucsc.edu/cgi-bin/hgTracks?db=hg38&chromInfoPage=
Signification
https://genome.ucsc.edu/FAQ/FAQdownloads.html#downloadAlt
- alt = séquences alternatives (utilisables)
- fix = patch (correction ou amélioration)
- random = séquence connue sur un chromosome mais non encore utilisée
** Pipelines prêt-à-l’emploi nextflow
Problème : nécessite singularity ou docker (ou conda)
Potentiellement utilisable avec nix...
** Zone de capture
GIAB fourni le .bed. INfo : https://support.illumina.com/sequencing/sequencing_kits/nextera-rapid-capture-exome-kit/downloads.html
* Données :data:
** TODO Remplacer bam par fastq sur mesocentre
Commande
*** STRT Supprimer les fastq non "paired"
nushell
Liste des fastq avec "paired-end" manquant
#+begin_src nu
ls **/*.fastq.gz | get name | path basename | split column "_" | get column1 | uniq -u | save single.txt
#+end_src
#+RESULTS:
: 62907927
: 62907970
: 62899606
: 62911287
:

[2.9377]

[2.17569]

ategy that producing different length of reads (all BGI platforms
 were 100 base pair read length while all Illumina platforms were 150 base pair
 read length). The read length effects, as a key factor between two platforms,
 would bring alignment bias and error which are higher for short reads and
 ultimately affect the variants calling especially the INDELs identification
#+end_quote
*** Débugger variant calling (haplotypecaller)
https://gatk.broadinstitute.org/hc/en-us/articles/360043491652-When-HaplotypeCaller-and-Mutect2-do-not-call-an-expected-variant
https://gatk.broadinstitute.org/hc/en-us/articles/360035891111-Expected-variant-at-a-specific-site-was-not-called
*** Hap.py
Format de sortie :
#+begin_src r
vcf_field_names(vcf, tag = "FORMAT")
#+end_src
#+RESULTS:
: FORMAT BD    1      String  Decision for call (TP/FP/FN/N)
: FORMAT BK    1      String  Sub-type for decision (match/mismatch type)
: FORMAT BVT   1      String  High-level variant type (SNP|INDEL).
: FORMAT BLT   1      String  High-level location type (het|homref|hetalt|homa
am = genotype mismatch
lm = allele/haplotype mismatch
. = non vu
**** On vérifie que am = genotype mismatch
référence  = T/T
high-confidence = T/C
notre = C/C
#+begin_src sh
bcftools filter -i 'POS=19196584'  /Work/Groups/bisonex/data/giab/GRCh38/HG001_GRCh38_1_22_v4.2.1_benchmark.vcf.gz | grep -v '#'
bcftools filter -i 'POS=19196584'  ../out/NA12878_NIST7035-dbsnp/variantCalling/haplotypecaller/NA12878_NIST.vcf.gz | grep -v '#'
#+end_src
#+RESULTS:
: NC_000022.11    19196584        .       T       C       50      PASS    platforms=5;platformnames=Illumina,PacBio,10X,Ion,Solid;datasets=5;datasetnames=HiSeqPE300x,CCS15kb_20kb,10XChromiumLR,IonExome,SolidSE75bp;callsets=7;callsetnames=HiSeqPE300xGATK,CCS15kb_20kbDV,CCS15kb_20kbGATK4,HiSeqPE300xfreebayes,10XLRGATK,IonExomeTVC,SolidSE75GATKHC;datasetsmissingcall=CGnormal;callable=CS_HiSeqPE300xGATK_callable,CS_CCS15kb_20kbDV_callable,CS_10XLRGATK_callable,CS_CCS15kb_20kbGATK4_callable,CS_HiSeqPE300xfreebayes_callable GT:PS:DP:ADALL:AD:GQ    0/1:.:781:109,123:138,150:348
: NC_000022.11    19196584        rs1061325       T       C       59.32   PASS    AC=2;AF=1;AN=2;DB;DP=2;ExcessHet=0;FS=0;MLEAC=1;MLEAF=0.5;MQ=60;QD=29.66;SOR=2.303      GT:AD:DP:GQ:PL  1/1:0,2:2:6:71,6,0
**** On vérifie que lm = allele/haplotype mismatch
référence  = CAA/CAA
high-confidence = CA/CA
notre = C/CA
#+begin_src sh
 bcftools filter -i 'POS=31277416'  /Work/Groups/bisonex/data/giab/GRCh38/HG001_GRCh38_1_22_v4.2.1_benchmark.vcf.gz | grep -v '#'
 bcftools filter -i 'POS=31277416'  ../out/NA12878_NIST7035-dbsnp/variantCalling/haplotypecaller/NA12878_NIST.vcf.gz | grep -v '#'
#+end_src
#+RESULTS:
: NC_000022.11    31277416        .       CA      C       50      PASS    platforms=3;platformnames=Illumina,PacBio,10X;datasets=3;datasetnames=HiSeqPE300x,CCS15kb_20kb,10XChromiumLR;callsets=4;callsetnames=HiSeqPE300xGATK,CCS15kb_20kbDV,10XLRGATK,HiSeqPE300xfreebayes;datasetsmissingcall=CCS15kb_20kb,CGnormal,IonExome,SolidSE75bp;callable=CS_HiSeqPE300xGATK_callable;difficultregion=GRCh38_AllHomopolymers_gt6bp_imperfectgt10bp_slop5,GRCh38_SimpleRepeat_imperfecthomopolgt10_slop5  GT:PS:DP:ADALL:AD:GQ    1/1:.:465:16,229:0,190:129
: NC_000022.11    31277416        rs57244615      CAA     C,CA    389.02  PASS    AC=1,1;AF=0.5,0.5;AN=2;BaseQRankSum=0.37;DB;DP=37;ExcessHet=0;FS=0;MLEAC=1,1;MLEAF=0.5,0.5;MQ=60;MQRankSum=0;QD=13.41;ReadPosRankSum=-0.651;SOR=0.572    GT:AD:DP:GQ:PL  1/2:5,10,14:29:64:406,202,313,64,0,88
* Idées
** Validation analytique
mail Yannis : données patients +/- simulées
*** Utiliser données GCAT et uploader le notre ?
https://www.nature.com/articles/ncomms7275
*** [#A] Variant calling : Genome in a bottle : NA12878 + autres
Résumé : https://www.nist.gov/programs-projects/genome-bottle
Manuscript : https://www.nature.com/articles/s41587-019-0054-x.epdf?author_access_token=E_1bL0MtBBwZr91xEsy6B9RgN0jAjWel9jnR3ZoTv0OLNnFBR7rUIZNDXq0DIKdg3w6KhBF8Rz2RWQFFc0St45kC6CZs3cDYc87HNHovbWSOubJHDa9CeJV-pN0BW_mQ0n7cM13KF2JRr_wAAn524w%3D%3D
Article comparant les variant calling : https://www.biorxiv.org/content/10.1101/2020.12.11.422022v1.full.pdf
**** KILL Tester le séquencage aussi
CLOSED: [2023-01-30 lun. 18:30]
Depuis un fastq correspondant à Illumina  https://github.com/genome-in-a-bottle/giab_data_indexes
   puis on compare le VCF avec les "high confidence"
On séquence directement NA12878 -> inutile pour le pipeline seul
**** TODO Tester seul la partie bioinformatique
   Tout résumé ici : https://www.nist.gov/programs-projects/genome-bottle
- methode https://ftp-trace.ncbi.nlm.nih.gov/ReferenceSamples/giab/data/NA12878/analysis/Illumina_PlatinumGenomes_NA12877_NA12878_09162015/IlluminaPlatinumGenomes-user-guide.pdf
- vcf
     https://ftp-trace.ncbi.nlm.nih.gov/ReferenceSamples/giab/release/NA12878_HG001/latest/GRCh38/
NB: à quoi correspond https://ftp-trace.ncbi.nlm.nih.gov/ReferenceSamples/giab/data/NA12878/analysis/Illumina_PlatinumGenomes_NA12877_NA12878_09162015/hg38/2.0.1/NA12878/ ??
   Article comparant les variant calling : https://www.biorxiv.org/content/10.1101/2020.12.11.422022v1.full.pdf
   Article pour vcfeval : https://www.nature.com/articles/s41587-019-0054-x
   La version 4 ajoute 273 gènes "clinically relevant" https://www.biorxiv.org/content/10.1101/2021.06.07.444885v3.full.pdf
   Ajout des zones "difficiles"
   https://www.biorxiv.org/content/10.1101/2020.07.24.212712v5.full.pdf
*** [#B] Pipeline : générer patient avec tous les variants retrouvés à Centogene
Comparaison de génération ADN (2019)
https://academic.oup.com/bfg/article/19/1/49/5680294
**** SimuSCop
https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-020-03665-5
https://github.com/qasimyu/simuscop
1. Crééer un modèle depuis bam + vcf : Setoprofile
2. Génerer données NGS
** Annotation :
*** Comparaison vep / snpeff et annovar
* Changement nouvelle version
- Dernière version du génome (la version "prête à l'emploi" est seulement GRCh38 sans les version patchées)
* Notes
** Nextflow
*** afficher les résultats d'un process/workflow
#+begin_src
lol.out.view()
#+end_src
Attention, ne fonctionne pas si plusieurs sortie:
#+begin_src
lol.out[0].view()
#+end_src
ou si /a/ est le nom de la sortie
#+begin_src
lol.out.a.view()
#+end_src
** Quelle version du génome ?
Il y a 2 notations pour les chrosome: Refseq (NC_0001) ou chr1, chr2...
dbSNP utilise Refseq
pour le fasta, 2 solutions
- refseq : "https://ftp.ncbi.nlm.nih.gov/refseq/H_sapiens/annotation/${genome}_latest/refseq_identifiers/${fna}.gz"
  -> nécessite d'indexer le fichier (long !)
- chromosome https://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/001/405/GCA_000001405.15_GRCh38/seqs_for_alignment_pipelines.ucsc_ids/
  -> nécessite d'annoter les chromosomes pour corriger (avec le fichier gff)
  On utilise la version chromosome donc on annote dbSNP (à faire)
** Performances
Ordinateur de Carine (WSL2) : 4h dont 1h15 alignement (parallélisé) et 1h15 haplotypecaller (séquentiel)
** Chromosomes NC, NT, NW
Correspondance :
https://genome.ucsc.edu/cgi-bin/hgTracks?db=hg38&chromInfoPage=
Signification
https://genome.ucsc.edu/FAQ/FAQdownloads.html#downloadAlt
- alt = séquences alternatives (utilisables)
- fix = patch (correction ou amélioration)
- random = séquence connue sur un chromosome mais non encore utilisée
** Pipelines prêt-à-l’emploi nextflow
Problème : nécessite singularity ou docker (ou conda)
Potentiellement utilisable avec nix...
** Validation : Quelles données de référence ?
Discussion avec Alexis
- Platinum genomes = génome seul
*** [[https://github.com/genome-in-a-bottle/giab_data_indexes][Genome in a bottle]]
  - NA12878 :
    - Illumina HiSeq Exome : fastq + capture
    - Illumina TruSeq Exome : bam, pas de capture
      ici ww
  - HG002,3,4
    - Illumina Whole Exome  : bam. le kit de capture est "Agilent SureSelect Human All Exon V5 kit" selon [[https://ftp-trace.ncbi.nlm.nih.gov/giab/ftp/data/AshkenazimTrio/analysis/OsloUniversityHospital_Exome_GATK_jointVC_11242015/README.txt][README]]. On peut les régions [[https://kb.10xgenomics.com/hc/en-us/articles/115004150923-Where-can-I-find-the-Agilent-Target-BED-files-][selon ce site]]
      Mais disponible directement
    https://ftp-trace.ncbi.nlm.nih.gov/giab/ftp/data/AshkenazimTrio/analysis/OsloUniversityHospital_Exome_GATK_jointVC_11242015/wex_Agilent_SureSelect_v05_b37.baits.slop50.merged.list
    testé sur chr311780-312086 : ok
Autres technologies non adaptées au pipeline (vu avec Alexis)
*** [[https://www.illumina.com/platinumgenomes.html][Platinum genome
]] Que du génome « sequenced to 50x depth on a HiSeq 2000 system”
Genome possible
** Zone de capture
GIAB fourni le .bed pour l'exome . INfo : https://support.illumina.com/sequencing/sequencing_kits/nextera-rapid-capture-exome-kit/downloads.html
* Données :data:
** TODO Remplacer bam par fastq sur mesocentre
Commande
*** STRT Supprimer les fastq non "paired"
nushell
Liste des fastq avec "paired-end" manquant
#+begin_src nu
ls **/*.fastq.gz | get name | path basename | split column "_" | get column1 | uniq -u | save single.txt
#+end_src
#+RESULTS:
: 62907927
: 62907970
: 62899606
: 62911287
:

Replacement in projects/bisonex.org at line 7 [3.35]

B:BD[4.48990] → [4.48990:49141]

B:BD[4.49141] → [2.17721:25762]

| INDEL | ALL    |        8937 |     7839 |     1098 |       11812 |      343 |      3520 |    45 |   283 |      0.877140 |         0.958635 |       0.
298002 |        0.916079 |
| INDEL | PASS   |        8937 |     7550 |     1387 |        9971 |      283 |      1964 |    30 |   242 |      0.844803 |         0.964656 |       0.196971 |        0.900760 |
| SNP   | ALL    |       52494 |    52125 |      369 |       90092 |      582 |     37348 |   107 |   354 |      0.992971 |         0.988966 |       0.414554 |        0.990964 |
| SNP   | PASS   |       52494 |    46920 |     5574 |       48078 |      143 |       992 |     8 |    97 |      0.893816 |         0.996963 |       0.020633 |        0.942576 |
**** TODO Version avec rtg-tools
**** TODO Faire fonctionner Tests
***** TODO Essai 2 : depuis nix develop:
#+begin_src
nix develop .#hap-py
genericBuild
#+end_src
Lancé initialement à la main, mais on peut maintenant utiliser run_tests
#+begin_src
HCDIR=bin/ ../src/sh/run_tests.sha
#+end_src
- [X] test boost
- [X] multimerge
- [X] hapenum
- [X] fp accuracy
- [X] faulty variant
- leftshift fails
- [X] other vcf
- [X] chr prefix
- [X] gvcf
- [X] decomp
- [X] contig lengt
- [X]  integration test
- [ ] scmp fails sur le type
- [X] giab
- [X] performance
- [ ] quantify fails sur le type
- [ ] stratified échec sur les résultats !
- [X] pg counting
- [ ] sompy: ne trouve pas Strelka dans somatic
phases="buildPhase checkPhase installPhase fixupPhase" genericBuild
#+end_src
**** KILL Reproduire les performances precisionchallenge : attention à HG002 et HG001!
CLOSED: [2023-04-01 Sat 19:43]
https://www.nist.gov/programs-projects/genome-bottle
***** KILL 0GOOR
CLOSED: [2023-04-01 Sat 19:40]
Le problème venait 1. de l'ADN et 2. du renommage des chromosomes qui était faux
****** DONE HG002
CLOSED: [2023-02-17 Fri 19:31]
 Type Filter  TRUTH.TOTAL  TRUTH.TP  TRUTH.FN  QUERY.TOTAL  QUERY.FP  QUERY.UNK  FP.gt  FP.al  METRIC.Recall  METRIC.Precision  METRIC.Frac_NA  METRIC.F1_Score
INDEL    ALL       525466    491355     34111      1156702     57724     605307   9384  25027       0.935084          0.895313        0.523304         0.914766
INDEL   PASS       525466    491355     34111      1156702     57724     605307   9384  25027       0.935084          0.895313        0.523304         0.914766
  SNP    ALL      3365115   3358399      6716      5666020     21995    2284364   4194   1125       0.998004          0.993496        0.403169         0.995745
  SNP   PASS      3365115   3358399      6716      5666020     21995    2284364   4194   1125       0.998004          0.993496        0.403169         0.995745
 TRUTH.TOTAL.TiTv_ratio  QUERY.TOTAL.TiTv_ratio  TRUTH.TOTAL.het_hom_ratio  QUERY.TOTAL.het_hom_ratio
                    NaN                     NaN                   1.528276                   2.752637
                    NaN                     NaN                   1.528276                   2.752637
               2.100129                1.473519                   1.581196                   1.795603
               2.100129                1.473519                   1.581196                   1.795603
***** KILL Avec python2
CLOSED: [2023-02-17 Fri 19:25]
****** KILL avec nix
CLOSED: [2023-02-17 Fri 19:25]
conda create -n python2 python=2.7 anaconda
****** KILL avec conda
CLOSED: [2023-02-17 Fri 19:25]
******* Gentoo: regex_error sur test...
Ok avec bash !
#+begin_src
anaconda3/bin/conda create --name py2 python=2.7
conda activate py2
conda install -c bioconda hap.py
#+end_src
******** Faire tourner les tests.
Il faut remplace bin/test_haplotypes par test_haplotypes dans src/sh/run_tests.sh
#+begin_src sh
 HGREF=../genome/GRCh38/GCA_000001405.15_GRCh38_no_alt_analysis_set.fasta HCDIR=~/anaconda3/envs/py2/bin bash src/sh/run_tests.sh
#+end_src
Echec:
test_haplotypes: /opt/conda/conda-bld/work/hap.py-0.3.7/src/c++/lib/tools/Fasta.cpp:81: MMappedFastaFile::MMappedFastaFile(const string&): Assertion `fd != -1' failed.
unknown location(0): fatal error in "testVariantPrimitiveSplitter": signal: SIGABRT (application abort requested)
/opt/conda/conda-bld/work/hap.py-0.3.7/src/c++/test/test_align.cpp(298): last checkpoint
******** Chr21
HGREF=../genome/GRCh38/GCA_000001405.15_GRCh38_no_alt_analysis_set.fasta hap.py        example/happy/PG_NA12878_chr21.vcf.gz       example/happy/NA12878_chr21.vcf.gz       -f example/happy/PG_Conf_chr21.bed.gz       -o test
******* Helios
échec
** DONE Exécution
CLOSED: [2022-09-13 Tue 21:37]
*** KILL test Bionix
*** KILL Implémenter execution avec Nix ?
Voir https://academic.oup.com/gigascience/article/9/11/giaa121/5987272?login=false
pour un exemple.
Probablement plus simple d’utiliser Nix pour gestion de l’environnement et snakemake pour l’exécution
Pas d’accès internet depuis le cluster
*** DONE nextflow
CLOSED: [2022-09-13 Tue 21:37]
**** TODO Bug scheduler SGE
Le job se fait tuer car l'utilisateur n'est pas passé correctement à nextflow
***** DONE Forcer l'utilisateur à l'exécution
CLOSED: [2023-04-01 Sat 17:57]
NXF_OPTS=-D"user.name=alex"
***** DONE Vérifier si le problème persiste avec 22.10.6
CLOSED: [2023-04-01 Sat 18:38] SCHEDULED: <2023-04-01 Sat>
oui
***** KILL Packager l'utilisateur dans le programme ?
Mauvaise idée..
** TODO Preprocessing avec nextflow
*** TODO Map to reference
**** TODO Sample ID dans header
/Work/Users/apraga/bisonex/out/63003856_S135/preprocessing/baserecalibrator
*** DONE Mark duplicate
CLOSED: [2022-10-09 Sun 22:30]
*** DONE Recalibrate base quality score
CLOSED: [2022-10-09 Sun 22:30]
** DONE Variant calling avec Nextflow
CLOSED: [2022-11-19 Sat 21:34]
*** DONE Haplotype caller
CLOSED: [2022-10-09 Sun 22:40]
*** DONE Filter variants
CLOSED: [2022-10-09 Sun 22:40]
*** DONE Filter common snp not clinvar path
CLOSED: [2022-11-07 Mon 23:00]
Voir [[*common dbSNP not clinvar patho][common dbSNP not clinvar patho]]
*** DONE Filter variant only in consensual sequence
CLOSED: [2022-11-08 Tue 22:23]
*** DONE Filter technical variants
CLOSED: [2022-11-19 Sat 21:34]
*** TODO Utilise AVX pour accélerer l'exécution
Sans cela, on a l'avertissement
#+begin_quote
17:28:00.720 INFO  PairHMM - OpenMP multi-threaded AVX-accelerated native PairHMM implementation is not supported
17:28:00.721 INFO  NativeLibraryLoader - Loading libgkl_utils.so from jar:file:/nix/store/cy9ckxqwrkifx7wf02hm4ww1p6lnbxg9-gatk-4.2.4.1/bin/gatk-package-4.2.4.1-local.jar!/com/intel/gkl/native/libgkl_utils.so
17:28:00.733 WARN  NativeLibraryLoader - Unable to load libgkl_utils.so from native/libgkl_utils.so (/Work/Users/apraga/bisonex/out/NA12878_NIST7035/preprocessing/applybqsr/libgkl_utils821485189051585397.so: libgomp.so.1: cannot open shared object file: No such file or directory)
17:28:00.733 WARN  IntelPairHmm - Intel GKL Utils not loaded
17:28:00.733 WARN  PairHMM - ***WARNING: Machine does not have the AVX instruction set support needed for the accelerated AVX PairHmm. Falling back to the MUCH slower LOGLESS_CACHING implementation!
17:28:00.763 INFO  ProgressMeter - Starting traversal
#+end_quote
libgomp.so est fourni par gcc donc il faut charger le module
 module load gcc@11.3.0/gcc-12.1.0
** TODO Annotation avec nextflow
*** TODO VEP
***** KILL Utiliser --gene-phenotype ?
CLOSED: [2023-03-15 mer. 13:43]
Vu avec alexis : bases de données non à jour
https://www.ensembl.org/info/genome/variation/phenotype/sources_phenotype_documentation.html
***** TODO Plugin pour CADD, pLI, LOEUF ?
https://www.ensembl.org/info/docs/tools/vep/script/vep_plugins.html#cadd
CADD: n’a pas réussi à le faire fonctionner
pLI, LOEUF : non demandé
***** TODO Utiliser l'option --hgvsg pour remplaer hgvsg.r ?
Non fait par Alexis, oubli a priori
***** TODO Ajout spliceAI ?
*** TODO Spip
**** TODO Checksum sur données
*** TODO Filtrer après VEP
**** TODO Remplacer avec simplement bcftools filter ?
*** TODO OMIM
**** TODO Remplacer script R par bcftools ?
**** TODO Remplacer script R par vep ?
*** TODO clinvar
**** TODO Remplacer script R par bcftools ?
**

[4.48990]

[2.25762]

| INDEL | ALL    |        8937 |     7839 |     1098 |       11812 |      343 |      3520 |    45 |   283 |      0.877140 |         0.958635 |       0.298002 |        0.916079 |
| INDEL | PASS   |        8937 |     7550 |     1387 |        9971 |      283 |      1964 |    30 |   242 |      0.844803 |         0.964656 |       0.196971 |        0.900760 |
| SNP   | ALL    |       52494 |    52125 |      369 |       90092 |      582 |     37348 |   107 |   354 |      0.992971 |         0.988966 |       0.414554 |        0.990964 |
| SNP   | PASS   |       52494 |    46920 |     5574 |       48078 |      143 |       992 |     8 |    97 |      0.893816 |         0.996963 |       0.020633 |        0.942576 |
**** TODO Version avec rtg-tools
**** TODO Faire fonctionner Tests
***** TODO Essai 2 : depuis nix develop:
#+begin_src
nix develop .#hap-py
genericBuild
#+end_src
Lancé initialement à la main, mais on peut maintenant utiliser run_tests
#+begin_src
HCDIR=bin/ ../src/sh/run_tests.sha
#+end_src
- [X] test boost
- [X] multimerge
- [X] hapenum
- [X] fp accuracy
- [X] faulty variant
- leftshift fails
- [X] other vcf
- [X] chr prefix
- [X] gvcf
- [X] decomp
- [X] contig lengt
- [X]  integration test
- [ ] scmp fails sur le type
- [X] giab
- [X] performance
- [ ] quantify fails sur le type
- [ ] stratified échec sur les résultats !
- [X] pg counting
- [ ] sompy: ne trouve pas Strelka dans somatic
phases="buildPhase checkPhase installPhase fixupPhase" genericBuild
#+end_src
**** KILL Reproduire les performances precisionchallenge : attention à HG002 et HG001!
CLOSED: [2023-04-01 Sat 19:43]
https://www.nist.gov/programs-projects/genome-bottle
***** KILL 0GOOR
CLOSED: [2023-04-01 Sat 19:40]
Le problème venait 1. de l'ADN et 2. du renommage des chromosomes qui était faux
****** DONE HG002
CLOSED: [2023-02-17 Fri 19:31]
 Type Filter  TRUTH.TOTAL  TRUTH.TP  TRUTH.FN  QUERY.TOTAL  QUERY.FP  QUERY.UNK  FP.gt  FP.al  METRIC.Recall  METRIC.Precision  METRIC.Frac_NA  METRIC.F1_Score
INDEL    ALL       525466    491355     34111      1156702     57724     605307   9384  25027       0.935084          0.895313        0.523304         0.914766
INDEL   PASS       525466    491355     34111      1156702     57724     605307   9384  25027       0.935084          0.895313        0.523304         0.914766
  SNP    ALL      3365115   3358399      6716      5666020     21995    2284364   4194   1125       0.998004          0.993496        0.403169         0.995745
  SNP   PASS      3365115   3358399      6716      5666020     21995    2284364   4194   1125       0.998004          0.993496        0.403169         0.995745
 TRUTH.TOTAL.TiTv_ratio  QUERY.TOTAL.TiTv_ratio  TRUTH.TOTAL.het_hom_ratio  QUERY.TOTAL.het_hom_ratio
                    NaN                     NaN                   1.528276                   2.752637
                    NaN                     NaN                   1.528276                   2.752637
               2.100129                1.473519                   1.581196                   1.795603
               2.100129                1.473519                   1.581196                   1.795603
***** KILL Avec python2
CLOSED: [2023-02-17 Fri 19:25]
****** KILL avec nix
CLOSED: [2023-02-17 Fri 19:25]
conda create -n python2 python=2.7 anaconda
****** KILL avec conda
CLOSED: [2023-02-17 Fri 19:25]
******* Gentoo: regex_error sur test...
Ok avec bash !
#+begin_src
anaconda3/bin/conda create --name py2 python=2.7
conda activate py2
conda install -c bioconda hap.py
#+end_src
******** Faire tourner les tests.
Il faut remplace bin/test_haplotypes par test_haplotypes dans src/sh/run_tests.sh
#+begin_src sh
 HGREF=../genome/GRCh38/GCA_000001405.15_GRCh38_no_alt_analysis_set.fasta HCDIR=~/anaconda3/envs/py2/bin bash src/sh/run_tests.sh
#+end_src
Echec:
test_haplotypes: /opt/conda/conda-bld/work/hap.py-0.3.7/src/c++/lib/tools/Fasta.cpp:81: MMappedFastaFile::MMappedFastaFile(const string&): Assertion `fd != -1' failed.
unknown location(0): fatal error in "testVariantPrimitiveSplitter": signal: SIGABRT (application abort requested)
/opt/conda/conda-bld/work/hap.py-0.3.7/src/c++/test/test_align.cpp(298): last checkpoint
******** Chr21
HGREF=../genome/GRCh38/GCA_000001405.15_GRCh38_no_alt_analysis_set.fasta hap.py        example/happy/PG_NA12878_chr21.vcf.gz       example/happy/NA12878_chr21.vcf.gz       -f example/happy/PG_Conf_chr21.bed.gz       -o test
******* Helios
échec
** DONE Exécution
CLOSED: [2022-09-13 Tue 21:37]
*** KILL test Bionix
*** KILL Implémenter execution avec Nix ?
Voir https://academic.oup.com/gigascience/article/9/11/giaa121/5987272?login=false
pour un exemple.
Probablement plus simple d’utiliser Nix pour gestion de l’environnement et snakemake pour l’exécution
Pas d’accès internet depuis le cluster
*** DONE nextflow
CLOSED: [2022-09-13 Tue 21:37]
**** TODO Bug scheduler SGE
Le job se fait tuer car l'utilisateur n'est pas passé correctement à nextflow
***** DONE Forcer l'utilisateur à l'exécution
CLOSED: [2023-04-01 Sat 17:57]
NXF_OPTS=-D"user.name=alex"
***** DONE Vérifier si le problème persiste avec 22.10.6
CLOSED: [2023-04-01 Sat 18:38] SCHEDULED: <2023-04-01 Sat>
oui
***** KILL Packager l'utilisateur dans le programme ?
Mauvaise idée..
** TODO Preprocessing avec nextflow
*** TODO Map to reference
**** TODO Sample ID dans header
/Work/Users/apraga/bisonex/out/63003856_S135/preprocessing/baserecalibrator
*** DONE Mark duplicate
CLOSED: [2022-10-09 Sun 22:30]
*** DONE Recalibrate base quality score
CLOSED: [2022-10-09 Sun 22:30]
** DONE Variant calling avec Nextflow
CLOSED: [2022-11-19 Sat 21:34]
*** DONE Haplotype caller
CLOSED: [2022-10-09 Sun 22:40]
*** DONE Filter variants
CLOSED: [2022-10-09 Sun 22:40]
*** DONE Filter common snp not clinvar path
CLOSED: [2022-11-07 Mon 23:00]
Voir [[*common dbSNP not clinvar patho][common dbSNP not clinvar patho]]
*** DONE Filter variant only in consensual sequence
CLOSED: [2022-11-08 Tue 22:23]
*** DONE Filter technical variants
CLOSED: [2022-11-19 Sat 21:34]
*** TODO Utilise AVX pour accélerer l'exécution
Sans cela, on a l'avertissement
#+begin_quote
17:28:00.720 INFO  PairHMM - OpenMP multi-threaded AVX-accelerated native PairHMM implementation is not supported
17:28:00.721 INFO  NativeLibraryLoader - Loading libgkl_utils.so from jar:file:/nix/store/cy9ckxqwrkifx7wf02hm4ww1p6lnbxg9-gatk-4.2.4.1/bin/gatk-package-4.2.4.1-local.jar!/com/intel/gkl/native/libgkl_utils.so
17:28:00.733 WARN  NativeLibraryLoader - Unable to load libgkl_utils.so from native/libgkl_utils.so (/Work/Users/apraga/bisonex/out/NA12878_NIST7035/preprocessing/applybqsr/libgkl_utils821485189051585397.so: libgomp.so.1: cannot open shared object file: No such file or directory)
17:28:00.733 WARN  IntelPairHmm - Intel GKL Utils not loaded
17:28:00.733 WARN  PairHMM - ***WARNING: Machine does not have the AVX instruction set support needed for the accelerated AVX PairHmm. Falling back to the MUCH slower LOGLESS_CACHING implementation!
17:28:00.763 INFO  ProgressMeter - Starting traversal
#+end_quote
libgomp.so est fourni par gcc donc il faut charger le module
 module load gcc@11.3.0/gcc-12.1.0
** KILL Utiliser subworkflow
CLOSED: [2023-04-02 Sun 18:08]
Notre version permet d'être plus souple
*** KILL Alignement
CLOSED: [2023-04-02 Sun 18:08] SCHEDULED: <2023-04-05 Wed>
*** KILL Vep
CLOSED: [2023-04-02 Sun 18:08] SCHEDULED: <2023-04-05 Wed>
vcf_annotate_ensemblvep
** TODO Annotation avec nextflow
*** TODO VEP
***** KILL Utiliser --gene-phenotype ?
CLOSED: [2023-03-15 mer. 13:43]
Vu avec alexis : bases de données non à jour
https://www.ensembl.org/info/genome/variation/phenotype/sources_phenotype_documentation.html
***** TODO Plugin pour CADD, pLI, LOEUF ?
https://www.ensembl.org/info/docs/tools/vep/script/vep_plugins.html#cadd
CADD: n’a pas réussi à le faire fonctionner
pLI, LOEUF : non demandé
***** TODO Utiliser l'option --hgvsg pour remplaer hgvsg.r ?
Non fait par Alexis, oubli a priori
***** TODO Ajout spliceAI ?
*** TODO Spip
**** TODO Checksum sur données
*** TODO Filtrer après VEP
**** TODO Remplacer avec simplement bcftools filter ?
*** TODO OMIM
**** TODO Remplacer script R par bcftools ?
**** TODO Remplacer script R par vep ?
*** TODO clinvar
**** TODO Remplacer script R par bcftools ?
**

Replacement in projects/bisonex.org at line 30 [3.35]

B:BD[5.32397] → [5.32397:32996]

B:BD[5.32996] → [2.26362:33955]

                                  | --gcs-project-for-requester-pays                                                        |
| --disable-tool-default-read-filters false	PN:GATK ApplyBQSR                                                 | --disable-tool-default-read-filters false     PN:GATK ApplyBQSR                         |
****** KILL Vérifier sha256sum
CLOSED: [2023-01-24 Tue 23:00]
alignment: différent
****** KILL Comparer bam
CLOSED: [2023-01-25 Wed 21:58]
/Work/Users/apraga/bisonex/script/files〉picard CompareSAMs LENIENT_LOW_MQ_ALIGNMENT=true LENIENT_DUP=true tmp_6300385
6_S135/63003856_S135.bam /Work/Groups/bisonex/ref/tmp_63003856_S135/63003856_S135.bam O=compare-bam.tsv
picard CompareSAMs -LENIENT_LOW_MQ_ALIGNMENT true -LENIENT_DUP true tmp_63003856_S135/63003856_S135.bam /Work/Groups/bisonex/ref/tmp_63003856_S135/63003856_S135.bam -O compare-bam.tsv
VN Program Record attribute differs.
File 1: 1.13
File 2: 1.10
SAM files differ.
[Tue Jan 24 23:12:50 CET 2023] picard.sam.CompareSAMs done. Elapsed time: 7.32 minutes.
***** DONE Relancer avec la même version de samtools
CLOSED: [2023-01-25 Wed 21:58]
Pas d'impact
***** TODO Comparer tsv de sortie
***** TODO Regarder où sont les variants différents
** TODO GIAB Validation : GIAB
https://github.com/ga4gh/benchmarking-tools
Prérequis :
- [[*hap.py][hap.py]]
- [[*NA12878][NA12878]]
*** TODO GIAB :giab:
**** Notes
https://github.com/genome-in-a-bottle/giab_FAQ
**** TODO télécharger données avec Nextflow
***** DONE Renommer les chromosomes
CLOSED: [2023-02-17 Fri 19:30]
****** DONE Genome de reference NCBI
CLOSED: [2023-02-25 Sat 19:46]
****** DONE Bed avec les exons
CLOSED: [2023-03-29 Wed 23:04]
****** DONE hg19
CLOSED: [2023-02-26 Sun 22:37]
****** DONE hg38
CLOSED: [2023-03-29 Wed 23:04]
- [X] Télécharger hg19 : ok
- [X] convertir bed en interval list
picard BedToIntervalList -I exons_illumina.bed  -O exons_illumina.list -SD  ../../genome/GRCh19/genomeRef.dict
- [X] puis en hg38
picard LiftOverIntervalList -I exons_illumina.list  -O exons_illumina_hg38.list --CHAIN hg19ToHg38.over.chain -SD  ../../genome/GRCh38.p13/genomeRef.dict
- [X] puis en bed
***** TODO VCF de référence
****** DONE NA12878 (HG001)
CLOSED: [2023-02-25 Sat 19:46]
******* DONE Fastq HiSeq
CLOSED: [2023-02-25 Sat 19:46]
On prend le Hiseq, qui est probablement ce qu'utilise Centogène :
https://ftp-trace.ncbi.nih.gov/ReferenceSamples/giab/data/NA12878/Garvan_NA12878_HG001_HiSeq_Exome/
On utilisé les données "trimmés" (https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-016-1069-7), i.e qui ont enlevé les fragments plus petits que la taille d'un read.
Informations:
- https://ftp-trace.ncbi.nih.gov/ReferenceSamples/giab/data/NA12878/Garvan_NA12878_HG001_HiSeq_Exome/Garvan_NA12878_HG001_HiSeq_Exome.README
- Sequencer: HiSeq2500
- kit: Nextera Rapid Capture Exome and Expanded Exome
Il y a 2 samples (NIST7035 et NIST7086), chacun sur 2 lanes -> à concaténer
NB : liste techno illumina https://www.illumina.com/systems/sequencing-platforms.html
Hiseq postérieur nextseq 550
******* DONE Capture : Exons (bed)
CLOSED: [2023-02-25 Sat 19:46]
https://ftp-trace.ncbi.nih.gov/ReferenceSamples/giab/data/NA12878/Garvan_NA12878_HG001_HiSeq_Exome/nexterarapidcapture_expandedexome_targetedregions.bed.gz
******* DONE Bed, vcf
CLOSED: [2023-02-24 Fri 23:45]
****** TODO Ashkenazy trio HG002
SCHEDULED: <2023-04-01 Sat>
****** TODO Ashkenazy trio HG003
SCHEDULED: <2023-04-01 Sat>
****** TODO Ashkenazy trio HG004
SCHEDULED: <2023-04-01 Sat>
****** TODO Chinese trio HG005
SCHEDULED: <2023-04-01 Sat>
****** TODO Chinese trio HG006
SCHEDULED: <2023-04-01 Sat>
****** TODO Chinese trio HG007
SCHEDULED: <2023-04-01 Sat>
*
***** TODO Fastq
****** DONE NA12878 (HG001)
CLOSED: [2023-02-25 Sat 19:46]
******* DONE Fastq HiSeq
CLOSED: [2023-02-25 Sat 19:46]
On prend le Hiseq, qui est probablement ce qu'utilise Centogène :
https://ftp-trace.ncbi.nih.gov/ReferenceSamples/giab/data/NA12878/Garvan_NA12878_HG001_HiSeq_Exome/
On utilisé les données "trimmés" (https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-016-1069-7), i.e qui ont enlevé les fragments plus petits que la taille d'un read.
Informations:
- https://ftp-trace.ncbi.nih.gov/ReferenceSamples/giab/data/NA12878/Garvan_NA12878_HG001_HiSeq_Exome/Garvan_NA12878_HG001_HiSeq_Exome.README
- Sequencer: HiSeq2500
- kit: Nextera Rapid Capture Exome and Expanded Exome
Il y a 2 samples (NIST7035 et NIST7086), chacun sur 2 lanes -> à concaténer
NB : liste techno illumina https://www.illumina.com/systems/sequencing-platforms.html
Hiseq postérieur nextseq 550
******* DONE Capture : Exons (bed)
CLOSED: [2023-02-25 Sat 19:46]
https://ftp-trace.ncbi.nih.gov/ReferenceSamples/giab/data/NA12878/Garvan_NA12878_HG001_HiSeq_Exome/nexterarapidcapture_expandedexome_targetedregions.bed.gz
******* DONE Bed, vcf
CLOSED: [2023-02-24 Fri 23:45]
****** TODO Ashkenazy trio HG002
SCHEDULED: <2023-04-01 Sat>
****** TODO Ashkenazy trio HG003
SCHEDULED: <2023-04-01 Sat>
****** TODO Ashkenazy trio HG004
SCHEDULED: <2023-04-01 Sat>
****** TODO Chinese trio HG005
SCHEDULED: <2023-04-01 Sat>
****** TODO Chinese trio HG006
SCHEDULED: <2023-04-01 Sat>
****** TODO Chinese trio HG007
SCHEDULED: <2023-04-01 Sat>
*
**** TODO NA12878 / HG001 :na12878:
***** DONE Discussion alexis : Mail
CLOSED: [2023-03-29 Wed 22:40]
Avec le patient NA12878 et comparaison avec hap.py du VCF de Genome In A Bottle ("gold" standard), on avait pour rappel
- sensibilité (=recall) 71% pour indel, 85% SNP
- précision  (= VPP) 69 et 97% respectivement
| Type  | TRUTH |    TP |   FN | QUERY |   FP |  UNK | FP.gt | FP.al |   Recall | Precision |
| INDEL |  4871 |  3461 | 1410 |  7048 | 1554 | 1987 |   193 |   346 | 0.710532 |  0.692946 |
| SNP   | 46032 | 39369 | 6663 | 44600 | 1186 | 4041 |   304 |    30 | 0.855253 |  0.970759 |
Les statistiques sur les génomes sont bien meilleurs (cf precisionFDA challenge).
Pour les exome, un article [1] a fait a des meilleures stats sur ce patient avec BWA et GATK mais ils ont moins de variant (on a presque un facteur 2 !).
Je soupçonne qu'on ne travaille pas sur les mêmes zones de capture (pas réussi à récupérer leur .bed)
| Exome | Type  |    TP |   FP |  FN | Sensitivity | Precision | F-Score |   FDR |
|     1 | SNV   | 23689 | 1397 | 613 |       0.975 |     0.944 |   0.959 | 0.057 |
|     2 | SNV   | 23946 |  865 | 356 |       0.985 |     0.965 |   0.975 | 0.036 |
|     1 | indel |  1254 |   72 |  75 |       0.944 |     0.946 |   0.945 | 0.054 |
|     2 | indel |  1309 |   10 |  20 |       0.985 |     0.992 |   0.989 | 0.008 |
Pour essayer d'améliorer les statistiques :
- La version du génome GRC38 vs GRCh38.p13 ne change quasiment rien
- Désactiver dbSNP ne change strictement rien pour le variant calling
J'ai exploré les faux négatifs :
- la grande majorité n'est juste pas vue (ce n'est pas un problème d'haploïde/génotype)
- la répartition par chromosome est relativement homogène, sauf sur le 6 ()
- la majorité est en 5' et 3'UTR (selon Best refseq)
Conclusion: je pense m'arrêter là pour la validation du variant calling par manque de temps. Il faudrait creuser pour savoir pourquoi certains variants ne sont pas vus par GATK mais ce n'est pas la majorité. En tout cas, je peux justifier d'une première analyse pour la thèse.
Ça te va ?
[1]
https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-019-2928-9
Résultats ici https://static-content.springer.com/esm/art%3A10.1186%2Fs12859-019-2928-9/MediaObjects/12859_2019_2928_MOESM8_ESM.pdf
***** DONE Comparaison
CLOSED: [2023-03-04 Sat 11:14]
HGREF=/Work/Groups/bisonex/data-alexis-reference/genome/GRCh38_latest_genomic.fna ./result/bin/hap.py /Work/Groups/bisonex/NA12878/HG001_GRCh38_1_22_v4.2.1
_benchmark_renamed.vcf.gz script/files/vcf/NA12878_NIST7035_vep_annot.vcf -f /Work/Groups/bison
ex/NA12878/HG001_GRCh38_1_22_v4.2.1_benchmark.bed -o test
na1878.slurm
#+begin_src slurm
#!/bin/bash
#SBATCH -c

[5.32397]

[2.33955]

                                  | --gcs-project-for-requester-pays                                                        |
| --disable-tool-default-read-filters false	PN:GATK ApplyBQSR                                                 | --disable-tool-default-read-filters false     PN:GATK ApplyBQSR                         |
****** KILL Vérifier sha256sum
CLOSED: [2023-01-24 Tue 23:00]
alignment: différent
****** KILL Comparer bam
CLOSED: [2023-01-25 Wed 21:58]
/Work/Users/apraga/bisonex/script/files〉picard CompareSAMs LENIENT_LOW_MQ_ALIGNMENT=true LENIENT_DUP=true tmp_63003856_S135/63003856_S135.bam /Work/Groups/bisonex/ref/tmp_63003856_S135/63003856_S135.bam O=compare-bam.tsv
picard CompareSAMs -LENIENT_LOW_MQ_ALIGNMENT true -LENIENT_DUP true tmp_63003856_S135/63003856_S135.bam /Work/Groups/bisonex/ref/tmp_63003856_S135/63003856_S135.bam -O compare-bam.tsv
VN Program Record attribute differs.
File 1: 1.13
File 2: 1.10
SAM files differ.
[Tue Jan 24 23:12:50 CET 2023] picard.sam.CompareSAMs done. Elapsed time: 7.32 minutes.
***** DONE Relancer avec la même version de samtools
CLOSED: [2023-01-25 Wed 21:58]
Pas d'impact
***** TODO Comparer tsv de sortie
***** TODO Regarder où sont les variants différents
** TODO GIAB Validation : GIAB
https://github.com/ga4gh/benchmarking-tools
Prérequis :
- [[*hap.py][hap.py]]
- [[*NA12878][NA12878]]
*** TODO GIAB : exome :giab:
**** Notes
https://github.com/genome-in-a-bottle/giab_FAQ
**** TODO télécharger données avec Nextflow
***** DONE Renommer les chromosomes
CLOSED: [2023-02-17 Fri 19:30]
****** DONE Genome de reference NCBI
CLOSED: [2023-02-25 Sat 19:46]
****** DONE Bed avec les exons
CLOSED: [2023-03-29 Wed 23:04]
****** DONE hg19
CLOSED: [2023-02-26 Sun 22:37]
****** DONE hg38
CLOSED: [2023-03-29 Wed 23:04]
- [X] Télécharger hg19 : ok
- [X] convertir bed en interval list
picard BedToIntervalList -I exons_illumina.bed  -O exons_illumina.list -SD  ../../genome/GRCh19/genomeRef.dict
- [X] puis en hg38
picard LiftOverIntervalList -I exons_illumina.list  -O exons_illumina_hg38.list --CHAIN hg19ToHg38.over.chain -SD  ../../genome/GRCh38.p13/genomeRef.dict
- [X] puis en bed
***** TODO VCF de référence
****** DONE NA12878 (HG001)
CLOSED: [2023-02-25 Sat 19:46]
******* DONE Fastq HiSeq
CLOSED: [2023-02-25 Sat 19:46]
On prend le Hiseq, qui est probablement ce qu'utilise Centogène :
https://ftp-trace.ncbi.nih.gov/ReferenceSamples/giab/data/NA12878/Garvan_NA12878_HG001_HiSeq_Exome/
On utilisé les données "trimmés" (https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-016-1069-7), i.e qui ont enlevé les fragments plus petits que la taille d'un read.
Informations:
- https://ftp-trace.ncbi.nih.gov/ReferenceSamples/giab/data/NA12878/Garvan_NA12878_HG001_HiSeq_Exome/Garvan_NA12878_HG001_HiSeq_Exome.README
- Sequencer: HiSeq2500
- kit: Nextera Rapid Capture Exome and Expanded Exome
Il y a 2 samples (NIST7035 et NIST7086), chacun sur 2 lanes -> à concaténer
NB : liste techno illumina https://www.illumina.com/systems/sequencing-platforms.html
Hiseq postérieur nextseq 550
******* DONE Capture : Exons (bed)
CLOSED: [2023-02-25 Sat 19:46]
https://ftp-trace.ncbi.nih.gov/ReferenceSamples/giab/data/NA12878/Garvan_NA12878_HG001_HiSeq_Exome/nexterarapidcapture_expandedexome_targetedregions.bed.gz
******* DONE Bed, vcf
CLOSED: [2023-02-24 Fri 23:45]
****** TODO Ashkenazy trio HG002, HG003, HGQ004
SCHEDULED: <2023-04-01 Sat>
****** TODO Chinese trio HG005, 6, 7
***** TODO Fastq
****** DONE NA12878 (HG001)
CLOSED: [2023-02-25 Sat 19:46]
******* DONE Fastq HiSeq
CLOSED: [2023-02-25 Sat 19:46]
On prend le Hiseq, qui est probablement ce qu'utilise Centogène :
https://ftp-trace.ncbi.nih.gov/ReferenceSamples/giab/data/NA12878/Garvan_NA12878_HG001_HiSeq_Exome/
On utilisé les données "trimmés" (https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-016-1069-7), i.e qui ont enlevé les fragments plus petits que la taille d'un read.
Informations:
- https://ftp-trace.ncbi.nih.gov/ReferenceSamples/giab/data/NA12878/Garvan_NA12878_HG001_HiSeq_Exome/Garvan_NA12878_HG001_HiSeq_Exome.README
- Sequencer: HiSeq2500
- kit: Nextera Rapid Capture Exome and Expanded Exome
Il y a 2 samples (NIST7035 et NIST7086), chacun sur 2 lanes -> à concaténer
NB : liste techno illumina https://www.illumina.com/systems/sequencing-platforms.html
Hiseq postérieur nextseq 550
******* DONE Capture : Exons (bed)
CLOSED: [2023-02-25 Sat 19:46]
https://ftp-trace.ncbi.nih.gov/ReferenceSamples/giab/data/NA12878/Garvan_NA12878_HG001_HiSeq_Exome/nexterarapidcapture_expandedexome_targetedregions.bed.gz
******* DONE Bed, vcf
CLOSED: [2023-02-24 Fri 23:45]
****** TODO Ashkenazy trio HG002, HG003, HG004
SCHEDULED: <2023-04-01 Sat>
******* TODO Capture
https://ftp-trace.ncbi.nlm.nih.gov/giab/ftp/data/AshkenazimTrio/analysis/OsloUniversityHospital_Exome_GATK_jointVC_11242015/wex_Agilent_SureSelect_v05_b37.baits.slop50.merged.list
******* TODO Bam à partir des fastq
Bam + index + checksum
https://raw.githubusercontent.com/genome-in-a-bottle/giab_data_indexes/master/AshkenazimTrio/alignment.index.AJtrio_OsloUniversityHospital_IlluminaExome_bwamem_GRCh37_11252015
*
****** TODO Chinese trio
Whole exome pour HG005 seulement
******* TODO HG005
https://raw.githubusercontent.com/genome-in-a-bottle/giab_data_indexes/master/ChineseTrio/alignment.index.Chinesetrio_HG005_OsloUniversityHospital_IlluminaExome_bwamem_GRCh37_11252015
**** TODO NA12878 / HG001 :na12878:
***** DONE Discussion alexis : Mail
CLOSED: [2023-03-29 Wed 22:40]
Avec le patient NA12878 et comparaison avec hap.py du VCF de Genome In A Bottle ("gold" standard), on avait pour rappel
- sensibilité (=recall) 71% pour indel, 85% SNP
- précision  (= VPP) 69 et 97% respectivement
| Type  | TRUTH |    TP |   FN | QUERY |   FP |  UNK | FP.gt | FP.al |   Recall | Precision |
| INDEL |  4871 |  3461 | 1410 |  7048 | 1554 | 1987 |   193 |   346 | 0.710532 |  0.692946 |
| SNP   | 46032 | 39369 | 6663 | 44600 | 1186 | 4041 |   304 |    30 | 0.855253 |  0.970759 |
Les statistiques sur les génomes sont bien meilleurs (cf precisionFDA challenge).
Pour les exome, un article [1] a fait a des meilleures stats sur ce patient avec BWA et GATK mais ils ont moins de variant (on a presque un facteur 2 !).
Je soupçonne qu'on ne travaille pas sur les mêmes zones de capture (pas réussi à récupérer leur .bed)
| Exome | Type  |    TP |   FP |  FN | Sensitivity | Precision | F-Score |   FDR |
|     1 | SNV   | 23689 | 1397 | 613 |       0.975 |     0.944 |   0.959 | 0.057 |
|     2 | SNV   | 23946 |  865 | 356 |       0.985 |     0.965 |   0.975 | 0.036 |
|     1 | indel |  1254 |   72 |  75 |       0.944 |     0.946 |   0.945 | 0.054 |
|     2 | indel |  1309 |   10 |  20 |       0.985 |     0.992 |   0.989 | 0.008 |
Pour essayer d'améliorer les statistiques :
- La version du génome GRC38 vs GRCh38.p13 ne change quasiment rien
- Désactiver dbSNP ne change strictement rien pour le variant calling
J'ai exploré les faux négatifs :
- la grande majorité n'est juste pas vue (ce n'est pas un problème d'haploïde/génotype)
- la répartition par chromosome est relativement homogène, sauf sur le 6 ()
- la majorité est en 5' et 3'UTR (selon Best refseq)
Conclusion: je pense m'arrêter là pour la validation du variant calling par manque de temps. Il faudrait creuser pour savoir pourquoi certains variants ne sont pas vus par GATK mais ce n'est pas la majorité. En tout cas, je peux justifier d'une première analyse pour la thèse.
Ça te va ?
[1]
https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-019-2928-9
Résultats ici https://static-content.springer.com/esm/art%3A10.1186%2Fs12859-019-2928-9/MediaObjects/12859_2019_2928_MOESM8_ESM.pdf
***** DONE Comparaison
CLOSED: [2023-03-04 Sat 11:14]
HGREF=/Work/Groups/bisonex/data-alexis-reference/genome/GRCh38_latest_genomic.fna ./result/bin/hap.py /Work/Groups/bisonex/NA12878/HG001_GRCh38_1_22_v4.2.1
_benchmark_renamed.vcf.gz script/files/vcf/NA12878_NIST7035_vep_annot.vcf -f /Work/Groups/bison
ex/NA12878/HG001_GRCh38_1_22_v4.2.1_benchmark.bed -o test
na1878.slurm
#+begin_src slurm
#!/bin/bash
#SBATCH -c

Replacement in projects/bisonex.org at line 35 [3.35]

B:BD[2.66723] → [2.66723:73591]

     1      54828     0.0000       0.0000     0.0000
     On essaie les différentes étapes
#+begin_src
multimerge test_align.vcf.gz -o out.vcf.gz -r /Work/Groups/bisonex/data/genome/GRCh38.p13/genomeRef.fna --homref-split 1 --homref-vcf-out 1 --trimalleles 1 --splitalleles 1
#+end_src
1er changement
TAA T
TAA TA
Après réflexion, c'est la référence qui n'est pas normalisée ! (left-trimmed)
******** DONE NC_000021.9     14108836  T -> C
CLOSED: [2023-03-04 Sat 11:01]
Dans le bam mais filtré par DP
******* DONE variant calling seul : meilleur score pour l'instant (77% recall, 95% precision)
CLOSED: [2023-03-04 Sat 11:01]
tests/chr21-alexis
 Type Filter  TRUTH.TOTAL  TRUTH.TP  TRUTH.FN  QUERY.TOTAL  QUERY.FP  QUERY.UNK  FP.gt  FP.al  METRIC.Recall  METRIC.Precision
INDEL    ALL           76        43        33           82        18         20      3      5       0.565789          0.709677
  SNP    ALL          582       448       134          530        25         57      6      1       0.769759          0.947146
 METRIC.Frac_NA  METRIC.F1_Score  TRUTH.TOTAL.TiTv_ratio  QUERY.TOTAL.TiTv_ratio  TRUTH.TOTAL.het_hom_ratio  QUERY.TOTAL.het_hom_ratio
       0.243902         0.629617                     NaN                     NaN                   1.181818                   1.612903
       0.107547         0.849289                3.098592                2.925926                   1.530435                   1.774869
******** NC_000021.9:14144627 : FN, dans le bam mais pas dans le vcf (2 reads/9)
 On récupére tout le vcf: pas dedans
 Dans le bam : 9/2
 Idem pour le bam dans notre pipeline
 - base qualité 33 sur les 2 reads
https://gatk.broadinstitute.org/hc/en-us/articles/360043491652-When-HaplotypeCaller-and-Mutect2-do-not-call-an-expected-variant
https://gatk.broadinstitute.org/hc/en-us/articles/360035891111-Expected-variant-at-a-specific-site-was-not-called
On debug
#+begin_src
cd /Work/Users/apraga/bisonex/out/NA12878_NIST7035/preprocessing/applybqsr
samtools view -b NA12878_NIST7035.bam NC_000021.9 -o NA12878_NIST7035_chr21.bam
samtools index NA12878_NIST7035_chr21.bam
#+end_src
********* --debug
#+begin_src
gatk --java-options "-Xmx3g" HaplotypeCaller --input NA12878_NIST7035_chr21.bam \
    --output debug_chr1.vcf.gz \
    --reference /Work/Groups/bisonex/data/genome/GRCh38.p13/genomeRef.fna \
    --dbsnp /Work/Groups/bisonex/data/dbSNP/GRCh38.p13/dbSNP.gz \
    --tmp-dir . \
    --max-mnp-distance 2 --debug &> lol.txt
#+end_src
Les allèles sont bien retrouvées
#+begin_quote
14:41:05.530 INFO  EventMap - === Best Haplotypes ===
14:41:05.530 INFO  EventMap - AATTTAATTTTCTTACCTTTCTGGGTATGTAAGTGATTTTA
14:41:05.530 INFO  EventMap - > Cigar = 41M
14:41:05.530 INFO  EventMap - >> Events = EventMap{}
14:41:05.530 INFO  EventMap - AATTTAATTTTCTTACCTTTTTGGGTATGTAAGTGATTTTA
14:41:05.530 INFO  EventMap - > Cigar = 41M
14:41:05.530 INFO  EventMap - >> Events = EventMap{NC_000021.9:14144627-14144627 [C*, T],}
14:41:05.530 INFO  HaplotypeCallerGenotypingEngine - Genotyping event at 14144627 with alleles = [C*, T]
#+end_quote
NB: même en filtranrt sur le chromosome 21 avec julia, haplotypecaller parcourt tous les chromosomes
********* DONE --linked-de-bruijn-graph : idem
CLOSED: [2023-02-26 Sun 17:26]
********* DONE examine sortie --bamout : non présent
CLOSED: [2023-02-26 Sun 19:53]
#+begin_src
cd test/chr21-alexis
gatk --java-options "-Xmx3g" HaplotypeCaller \
    --input /Work/Users/apraga/bisonex/script/files/bam/NA12878_chr21.bam \
    --output debug_chr1.vcf.gz \
    --reference /Work/Groups/bisonex/data/genome/GRCh38.p13/genomeRef.fna \
    --dbsnp /Work/Groups/bisonex/data/dbSNP/GRCh38.p13/dbSNP.gz \
    --tmp-dir . \
    --max-mnp-distance 2 -bamout debug.bam
#+end_src
Pas de reads
 #+begin_quote
If you see nothing overlapping your region, then it might not have been flagged as active, or could have failed to assemble.
 #+end_quote
********* 14582339: FN mais pas de reads...
********* 14583327 idem
********* 17512551 idem
********* 17567111: difference d'haplotype
********* 17567621 pas de reads
****** DONE Comparer avec sortie du variant calling vcf donné par GIAB
CLOSED: [2023-04-02 Sun 17:11]
******* DONE vcfeval
CLOSED: [2023-04-01 Sat 11:59] SCHEDULED: <2023-04-01 Sat>
#+begin_src sh
 nextflow run workflows/test.nf -profile standard,helios -resume --test.vcfeval --test.giabVCF --outdir=test-giabVCF
cat test-giabVCF/vcfeval/output/summary.txt
#+end_src
Threshold  True-pos-baseline  True-pos-call  False-pos  False-neg  Precision  Sensitivity  F-measure
----------------------------------------------------------------------------------------------------
    1.000              44818          44818       2892       6087     0.9394       0.8804     0.9089
     None              44819          44819       2896       6086     0.9393       0.8804     0.9089
Threshold  True-pos-baseline  True-pos-call  False-pos  False-neg  Precision  Sensitivity  F-measure
----------------------------------------------------------------------------------------------------
    1.000              44818          44818       2892       6087     0.9394       0.8804     0.9089
     None              44819          44819       2896       6086     0.9393       0.8804     0.9089
******* DONE happy
CLOSED: [2023-04-01 Sat 11:56]
 Type Filter  TRUTH.TOTAL  TRUTH.TP  TRUTH.FN  QUERY.TOTAL  QUERY.FP  QUERY.UNK  FP.gt  FP.al  METRIC.Recall  METRIC.PrecisioN
INDEL   PASS         4871      3678      1193         7036      1299       2011    208    217       0.755081          0.741493
  SNP   PASS        46032     41138      4894        47694      1622       4930    362     31       0.893683          0.962071
 METRIC.Frac_NA  METRIC.F1_Score  TRUTH.TOTAL.TiTv_ratio  QUERY.TOTAL.TiTv_ratio  TRUTH.TOTAL.het_hom_ratio  QUERY.TOTAL.het_hom_ratio
       0.285816         0.748225                     NaN                     NaN                   1.617499                   2.524051
       0.103367         0.926617                2.529552                2.412446                   1.620686                   1.688868
****** DONE Statistiques avec vcfeval
CLOSED: [2023-04-02 Sun 17:10] SCHEDULED: <2023-04-01 Sat>
**** TODO Résumer résultats pour Paul + article :resultats:
SCHEDULED: <2023-04-02 Sun>
***** TODO HG001 :
SCHEDULED: <2023-04-02 Sun>
- notre version avec hap.py + vcfeval
- version GIAB
- référence ??
***** TODO HG002
SCHEDULED: <2023-04-02 Sun>
*** TODO Platinum genome
https://emea.illumina.com/platinumgenomes.html
*** TODO Séquencer NA12878
Discussion avec Paul : sous-traitant ne nous donnera pas les données, il faut commander l'ADN
** Divers
*** DONE Vérifier nombre de reads fastq - bam
CLOSED: [2022-10-09 Sun 22:31]

[2.66723]

     1      54828     0.0000       0.0000     0.0000
     On essaie les différentes étapes
#+begin_src
multimerge test_align.vcf.gz -o out.vcf.gz -r /Work/Groups/bisonex/data/genome/GRCh38.p13/genomeRef.fna --homref-split 1 --homref-vcf-out 1 --trimalleles 1 --splitalleles 1
#+end_src
1er changement
TAA T
TAA TA
Après réflexion, c'est la référence qui n'est pas normalisée ! (left-trimmed)
******** DONE NC_000021.9     14108836  T -> C
CLOSED: [2023-03-04 Sat 11:01]
Dans le bam mais filtré par DP
******* DONE variant calling seul : meilleur score pour l'instant (77% recall, 95% precision)
CLOSED: [2023-03-04 Sat 11:01]
tests/chr21-alexis
 Type Filter  TRUTH.TOTAL  TRUTH.TP  TRUTH.FN  QUERY.TOTAL  QUERY.FP  QUERY.UNK  FP.gt  FP.al  METRIC.Recall  METRIC.Precision
INDEL    ALL           76        43        33           82        18         20      3      5       0.565789          0.709677
  SNP    ALL          582       448       134          530        25         57      6      1       0.769759          0.947146
 METRIC.Frac_NA  METRIC.F1_Score  TRUTH.TOTAL.TiTv_ratio  QUERY.TOTAL.TiTv_ratio  TRUTH.TOTAL.het_hom_ratio  QUERY.TOTAL.het_hom_ratio
       0.243902         0.629617                     NaN                     NaN                   1.181818                   1.612903
       0.107547         0.849289                3.098592                2.925926                   1.530435                   1.774869
******** NC_000021.9:14144627 : FN, dans le bam mais pas dans le vcf (2 reads/9)
 On récupére tout le vcf: pas dedans
 Dans le bam : 9/2
 Idem pour le bam dans notre pipeline
 - base qualité 33 sur les 2 reads
https://gatk.broadinstitute.org/hc/en-us/articles/360043491652-When-HaplotypeCaller-and-Mutect2-do-not-call-an-expected-variant
https://gatk.broadinstitute.org/hc/en-us/articles/360035891111-Expected-variant-at-a-specific-site-was-not-called
On debug
#+begin_src
cd /Work/Users/apraga/bisonex/out/NA12878_NIST7035/preprocessing/applybqsr
samtools view -b NA12878_NIST7035.bam NC_000021.9 -o NA12878_NIST7035_chr21.bam
samtools index NA12878_NIST7035_chr21.bam
#+end_src
********* --debug
#+begin_src
gatk --java-options "-Xmx3g" HaplotypeCaller --input NA12878_NIST7035_chr21.bam \
    --output debug_chr1.vcf.gz \
    --reference /Work/Groups/bisonex/data/genome/GRCh38.p13/genomeRef.fna \
    --dbsnp /Work/Groups/bisonex/data/dbSNP/GRCh38.p13/dbSNP.gz \
    --tmp-dir . \
    --max-mnp-distance 2 --debug &> lol.txt
#+end_src
Les allèles sont bien retrouvées
#+begin_quote
14:41:05.530 INFO  EventMap - === Best Haplotypes ===
14:41:05.530 INFO  EventMap - AATTTAATTTTCTTACCTTTCTGGGTATGTAAGTGATTTTA
14:41:05.530 INFO  EventMap - > Cigar = 41M
14:41:05.530 INFO  EventMap - >> Events = EventMap{}
14:41:05.530 INFO  EventMap - AATTTAATTTTCTTACCTTTTTGGGTATGTAAGTGATTTTA
14:41:05.530 INFO  EventMap - > Cigar = 41M
14:41:05.530 INFO  EventMap - >> Events = EventMap{NC_000021.9:14144627-14144627 [C*, T],}
14:41:05.530 INFO  HaplotypeCallerGenotypingEngine - Genotyping event at 14144627 with alleles = [C*, T]
#+end_quote
NB: même en filtranrt sur le chromosome 21 avec julia, haplotypecaller parcourt tous les chromosomes
********* DONE --linked-de-bruijn-graph : idem
CLOSED: [2023-02-26 Sun 17:26]
********* DONE examine sortie --bamout : non présent
CLOSED: [2023-02-26 Sun 19:53]
#+begin_src
cd test/chr21-alexis
gatk --java-options "-Xmx3g" HaplotypeCaller \
    --input /Work/Users/apraga/bisonex/script/files/bam/NA12878_chr21.bam \
    --output debug_chr1.vcf.gz \
    --reference /Work/Groups/bisonex/data/genome/GRCh38.p13/genomeRef.fna \
    --dbsnp /Work/Groups/bisonex/data/dbSNP/GRCh38.p13/dbSNP.gz \
    --tmp-dir . \
    --max-mnp-distance 2 -bamout debug.bam
#+end_src
Pas de reads
 #+begin_quote
If you see nothing overlapping your region, then it might not have been flagged as active, or could have failed to assemble.
 #+end_quote
********* 14582339: FN mais pas de reads...
********* 14583327 idem
********* 17512551 idem
********* 17567111: difference d'haplotype
********* 17567621 pas de reads
****** DONE Comparer avec sortie du variant calling vcf donné par GIAB
CLOSED: [2023-04-02 Sun 17:11]
******* DONE vcfeval
CLOSED: [2023-04-01 Sat 11:59] SCHEDULED: <2023-04-01 Sat>
#+begin_src sh
 nextflow run workflows/test.nf -profile standard,helios -resume --test.vcfeval --test.giabVCF --outdir=test-giabVCF
cat test-giabVCF/vcfeval/output/summary.txt
#+end_src
Threshold  True-pos-baseline  True-pos-call  False-pos  False-neg  Precision  Sensitivity  F-measure
----------------------------------------------------------------------------------------------------
    1.000              44818          44818       2892       6087     0.9394       0.8804     0.9089
     None              44819          44819       2896       6086     0.9393       0.8804     0.9089
Threshold  True-pos-baseline  True-pos-call  False-pos  False-neg  Precision  Sensitivity  F-measure
----------------------------------------------------------------------------------------------------
    1.000              44818          44818       2892       6087     0.9394       0.8804     0.9089
     None              44819          44819       2896       6086     0.9393       0.8804     0.9089
******* DONE happy
CLOSED: [2023-04-01 Sat 11:56]
 Type Filter  TRUTH.TOTAL  TRUTH.TP  TRUTH.FN  QUERY.TOTAL  QUERY.FP  QUERY.UNK  FP.gt  FP.al  METRIC.Recall  METRIC.PrecisioN
INDEL   PASS         4871      3678      1193         7036      1299       2011    208    217       0.755081          0.741493
  SNP   PASS        46032     41138      4894        47694      1622       4930    362     31       0.893683          0.962071
 METRIC.Frac_NA  METRIC.F1_Score  TRUTH.TOTAL.TiTv_ratio  QUERY.TOTAL.TiTv_ratio  TRUTH.TOTAL.het_hom_ratio  QUERY.TOTAL.het_hom_ratio
       0.285816         0.748225                     NaN                     NaN                   1.617499                   2.524051
       0.103367         0.926617                2.529552                2.412446                   1.620686                   1.688868
****** DONE Statistiques avec vcfeval
CLOSED: [2023-04-02 Sun 17:10] SCHEDULED: <2023-04-01 Sat>
**** TODO Résumer résultats pour Paul + article :resultats:
SCHEDULED: <2023-04-02 Sun>
***** TODO HG001 :
SCHEDULED: <2023-04-02 Sun>
****** Données brutes
Version GIAB avec hap.py + vcfeval:
#+begin_src sh
NXF_OPTS=-D"user.name=${USER}" nextflow run workflows/test.nf -profile standard,helios -resume --outdir=compareNA12878-giab --test.happy  --test.query=giab --test.vcfeval
#+end_src
Notre version avec hap.py + vcfeval
#+begin_src sh
NXF_OPTS=-D"user.name=${USER}" nextflow run workflows/test.nf -profile standard,helios -resume --outdir=compareNA12878 --test.vcfeval --test.query="out/NA12878_NIST/variantCalling/haplotypecaller/NA12878_NIST.vcf.gz" --test.happy
#+end_src
On concatene les csv avec une colonne indicant le type
# awk '{if (NR==1) {print "Data,Algorithm" $0} else {print "bisonx,happy,"$0}}' compareNA12878/happy/NA12878.summary.csv
compareNA12878/happy/NA12878.summary.csv
| Type  | Filter | TRUTH.TOTAL | TRUTH.TP | TRUTH.FN | QUERY.TOTAL | QUERY.FP | QUERY.UNK | FP.gt | FP.al | METRIC.Recall | METRIC.Precision | METRIC.Frac_NA | METRIC.F1_Score | TRUTH.TOTAL.TiTv_ratio | QUERY.TOTAL.TiTv_ratio | TRUTH.TOTAL.het_hom_ratio | QUERY.TOTAL.het_hom_ratio |
| INDEL | ALL    |        4871 |     3461 |     1410 |        7048 |     1554 |      1987 |   193 |   346 |      0.710532 |         0.692946 |       0.281924 |        0.701629 |                        |                        |        1.6174985978687606 |        3.0674091441969518 |
| INDEL | PASS   |        4871 |     3461 |     1410 |        7048 |     1554 |      1987 |   193 |   346 |      0.710532 |         0.692946 |       0.281924 |        0.701629 |                        |                        |        1.6174985978687606 |        3.0674091441969518 |
| SNP   | ALL    |       46032 |    39367 |     6665 |       44599 |     1186 |      4042 |   304 |    30 |      0.855209 |         0.970757 |        0.09063 |        0.909327 |      2.529551552318896 |      2.402150701647346 |        1.6206857273037931 |        1.6273423688862698 |
| SNP   | PASS   |       46032 |    39367 |     6665 |       44599 |     1186 |      4042 |   304 |    30 |      0.855209 |         0.970757 |        0.09063 |        0.909327 |      2.529551552318896 |      2.402150701647346 |        1.6206857273037931 |        1.6273423688862698 |
compareNA12878/vcfeval/NA12878.summary.txt
| Threshold | True-pos-baseline | True-pos-call | False-pos | False-neg | Precision | Sensitivity | F-measure |
|-----------+-------------------+---------------+-----------+-----------+-----------+-------------+-----------|
| 3.000     |             42789 |         42416 |      2598 |      8080 |    0.9423 |      0.8412 |    0.8889 |
| None      |             42798 |         42425 |      2616 |      8071 |    0.9419 |      0.8413 |    0.8888 |
compareNA12878-giab/vcfeval/NA12878.summary.txt
| Threshold | True-pos-baseline | True-pos-call | False-pos | False-neg | Precision | Sensitivity | F-measure |
| 1.000     |             44812 |         44812 |      2878 |      6057 |    0.9397 |      0.8809 |    0.9093 |
| None      |             44813 |         44813 |      2882 |      6056 |    0.9396 |      0.8809 |    0.9093 |
|           |                   |               |           |           |           |             |           |
compareNA12878-giab/happy/NA12878.summary.csv
| Type  | Filter | TRUTH.TOTAL | TRUTH.TP | TRUTH.FN | QUERY.TOTAL | QUERY.FP | QUERY.UNK | FP.gt | FP.al | METRIC.Recall | METRIC.Precision | METRIC.Frac_NA | METRIC.F1_Score | TRUTH.TOTAL.TiTv_ratio | QUERY.TOTAL.TiTv_ratio | TRUTH.TOTAL.het_hom_ratio | QUERY.TOTAL.het_hom_ratio |
|-------+--------+-------------+----------+----------+-------------+----------+-----------+-------+-------+---------------+------------------+----------------+-----------------+------------------------+------------------------+---------------------------+---------------------------|
| INDEL | ALL    |        4871 |     3678 |     1193 |        7036 |     1299 |      2011 |   208 |   217 |      0.755081 |         0.741493 |       0.285816 |        0.748225 |                        |                        |        1.6174985978687606 |        2.5240506329113925 |
| INDEL | PASS   |        4871 |     3678 |     1193 |        7036 |     1299 |      2011 |   208 |   217 |      0.755081 |         0.741493 |       0.285816 |        0.748225 |                        |                        |        1.6174985978687606 |        2.5240506329113925 |
| SNP   | ALL    |       46032 |    41138 |     4894 |       47694 |     1622 |      4930 |   362 |    31 |      0.893683 |         0.962071 |       0.103367 |        0.926617 |      2.529551552318896 |     2.4124463519313304 |        1.6206857273037931 |        1.6888675840288743 |
| SNP   | PASS   |       46032 |    41138 |     4894 |       47694 |     1622 |      4930 |   362 |    31 |      0.893683 |         0.962071 |       0.103367 |        0.926617 |      2.529551552318896 |     2.4124463519313304 |        1.6206857273037931 |         1.688867584028874 |
****** Résumé
| Données | Algorithm | Type  |   Recall | Precision |
|---------+-----------+-------+----------+-----------|
| Bisonex | Happy     | INDEL | 0.710532 |  0.692946 |
| Bisonex | Happy     | SNP   | 0.855209 |  0.970757 |
| Bisonex | vcfeval   | Tous  |   0.8413 |    0.9419 |
|---------+-----------+-------+----------+-----------|
| GIAB    | happy     | INDEL | 0.755081 |  0.741493 |
| GIAB    | happy     | SNP   | 0.893683 |  0.962071 |
| giab    | vcfeval   | Tous  |   0.8809 |    0.9396 |
***** WAIT Ashkenazi trio (père, mère)
SCHEDULED: <2023-04-02 Sun>
*** TODO Platinum genome
https://emea.illumina.com/platinumgenomes.html
*** TODO Séquencer NA12878
Discussion avec Paul : sous-traitant ne nous donnera pas les données, il faut commander l'ADN
** Divers
*** DONE Vérifier nombre de reads fastq - bam
CLOSED: [2022-10-09 Sun 22:31]