apraga/org - Change FHMBL4MNWYGMWDOI7MAT2TF5CH5Q6KUTN6EXOFU23G25SD5DQORQC

Hémolyse, ambler

Created by Alexis Praga on June 29, 2023

FHMBL4MNWYGMWDOI7MAT2TF5CH5Q6KUTN6EXOFU23G25SD5DQORQC

Dependencies

In channels

main

Change contents

Replacement in projects/bisonex.org at line 32 [4.35]

B:BD[3.24607] → [2.120:8312]

/
On utilisé les données "trimmés" (https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-016-1069-7), i.e qui ont enlevé les fragments plus petits que la taille d'un read.
Informations:
- https://ftp-trace.ncbi.nih.gov/ReferenceSamples/giab/data/NA12878/Garvan_NA12878_HG001_HiSeq_Exome/Garvan_NA12878_HG001_HiSeq_Exome.README
- Sequencer: HiSeq2500
- kit: Nextera Rapid Capture Exome and Expanded Exome
Il y a 2 samples (NIST7035 et NIST7086), chacun sur 2 lanes -> à concaténer
NB : liste techno illumina https://www.illumina.com/systems/sequencing-platforms.html
Hiseq postérieur nextseq 550
******* TODO Fastq hiseq sans trimming
******* DONE Capture : Exons (bed)
CLOSED: [2023-02-25 Sat 19:46]
https://ftp-trace.ncbi.nih.gov/ReferenceSamples/giab/data/NA12878/Garvan_NA12878_HG001_HiSeq_Exome/nexterarapidcapture_expandedexome_targetedregions.bed.gz
******* DONE Bed, vcf
CLOSED: [2023-02-24 Fri 23:45]
****** DONE Ashkenazy trio HG002, HG003, HGQ004
CLOSED: [2023-04-06 Thu 21:43] SCHEDULED: <2023-04-01 Sat>
****** KILL Chinese trio HG005, 6, 7
CLOSED: [2023-04-16 Sun 16:32]
***** KILL Fastq :fastq:
CLOSED: [2023-04-16 Sun 16:32]
****** DONE NA12878 (HG001)
CLOSED: [2023-02-25 Sat 19:46]
******* DONE Fastq HiSeq
CLOSED: [2023-02-25 Sat 19:46]
On prend le Hiseq, qui est probablement ce qu'utilise Centogène :
https://ftp-trace.ncbi.nih.gov/ReferenceSamples/giab/data/NA12878/Garvan_NA12878_HG001_HiSeq_Exome/
On utilisé les données "trimmés" (https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-016-1069-7), i.e qui ont enlevé les fragments plus petits que la taille d'un read.
Informations:
- https://ftp-trace.ncbi.nih.gov/ReferenceSamples/giab/data/NA12878/Garvan_NA12878_HG001_HiSeq_Exome/Garvan_NA12878_HG001_HiSeq_Exome.README
- Sequencer: HiSeq2500
- kit: Nextera Rapid Capture Exome and Expanded Exome
Il y a 2 samples (NIST7035 et NIST7086), chacun sur 2 lanes -> à concaténer
NB : liste techno illumina https://www.illumina.com/systems/sequencing-platforms.html
Hiseq postérieur nextseq 550
******* DONE Capture : Exons (bed)
CLOSED: [2023-02-25 Sat 19:46]
https://ftp-trace.ncbi.nih.gov/ReferenceSamples/giab/data/NA12878/Garvan_NA12878_HG001_HiSeq_Exome/nexterarapidcapture_expandedexome_targetedregions.bed.gz
****** DONE Ashkenazy trio HG002, HG003, HG004
CLOSED: [2023-04-15 Sat 23:24] SCHEDULED: <2023-04-05 Wed>
******* DONE Capture
CLOSED: [2023-04-15 Sat 23:24]
https://ftp-trace.ncbi.nlm.nih.gov/giab/ftp/data/AshkenazimTrio/analysis/OsloUniversityHospital_Exome_GATK_jointVC_11242015/wex_Agilent_SureSelect_v05_b37.baits.slop50.merged.list
******* DONE Capture Agilent
CLOSED: [2023-04-15 Sat 23:24]
******* DONE Bam à partir des fastq
CLOSED: [2023-04-15 Sat 23:24]
Bam + index + checksum
https://raw.githubusercontent.com/genome-in-a-bottle/giab_data_indexes/master/AshkenazimTrio/alignment.index.AJtrio_OsloUniversityHospital_IlluminaExome_bwamem_GRCh37_11252015
****** KILL Chinese trio
CLOSED: [2023-04-16 Sun 16:32]
Whole exome pour HG005 seulement
******* KILL HG005
CLOSED: [2023-04-16 Sun 16:32]
https://raw.githubusercontent.com/genome-in-a-bottle/giab_data_indexes/master/ChineseTrio/alignment.index.Chinesetrio_HG005_OsloUniversityHospital_IlluminaExome_bwamem_GRCh37_11252015
**** TODO Télécharger FASTQ directement avec aws (via SRA)
SCHEDULED: <2023-06-27 Tue>
***** Remarques
Numéro d'accession : https://bmcgenomics.biomedcentral.com/articles/10.1186/s12864-022-08365-3/tables/1
Fastq disponible via SRA. Avec AWS, on peut accéder au fastq directement.
(Sinon il faut convertir SRA -> Fastq avec le toolkit : compliqué à configurer)
Exemple: https://trace.ncbi.nlm.nih.gov/Traces/?view=run_browser&acc=SRR2962669&display=data-access
Avantage:
- pas de conversion BAM -> fASTQ
- détail des capture
- capture en hg38 sur site du constructeur !!
- capture semblable pour ashkenazi
Inconvénient :
- NA12878 : discordance pour le nombre de paires de bases : NA12878 = 49G (donc 24G de fastq)
- capture non disponible en ligne (site agilent)
***** Liste des runs :
https://www.ncbi.nlm.nih.gov/sra
Cherche avec numéro patient. On a le choix entre plusieurs séquenceurs Illumina
- NovaSeq 6000 TruSeq capture SRX11061536
- NovaSeq 6000 IDT capture SRX11061526
- NovaSeq 6000 Agilent SureSelect v7 capture SRX11061516
- HiSeq 4000 TruSeq capture SRX11061506
- HiSeq 4000 IDT capture SRX11061496
- HiSeq 4000 Agilent SureSelect v7 capture SRX11061486
  Note trueseq non disponible ?
  hg19 : https://www.biostars.org/p/144554/
IDT: lequel
https://www.idtdna.com/pages/products/next-generation-sequencing/workflow/xgen-ngs-hybridization-capture/pre-designed-hyb-cap-panels/exome-hyb-panel-v2
**** TODO NA12878 :na12878:hg38:
***** DONE Discussion alexis : Mail
CLOSED: [2023-03-29 Wed 22:40]
Avec le patient NA12878 et comparaison avec hap.py du VCF de Genome In A Bottle ("gold" standard), on avait pour rappel
- sensibilité (=recall) 71% pour indel, 85% SNP
- précision  (= VPP) 69 et 97% respectivement
| Type  | TRUTH |    TP |   FN | QUERY |   FP |  UNK | FP.gt | FP.al |   Recall | Precision |
| INDEL |  4871 |  3461 | 1410 |  7048 | 1554 | 1987 |   193 |   346 | 0.710532 |  0.692946 |
| SNP   | 46032 | 39369 | 6663 | 44600 | 1186 | 4041 |   304 |    30 | 0.855253 |  0.970759 |
Les statistiques sur les génomes sont bien meilleurs (cf precisionFDA challenge).
Pour les exome, un article [1] a fait a des meilleures stats sur ce patient avec BWA et GATK mais ils ont moins de variant (on a presque un facteur 2 !).
Je soupçonne qu'on ne travaille pas sur les mêmes zones de capture (pas réussi à récupérer leur .bed)
| Exome | Type  |    TP |   FP |  FN | Sensitivity | Precision | F-Score |   FDR |
|     1 | SNV   | 23689 | 1397 | 613 |       0.975 |     0.944 |   0.959 | 0.057 |
|     2 | SNV   | 23946 |  865 | 356 |       0.985 |     0.965 |   0.975 | 0.036 |
|     1 | indel |  1254 |   72 |  75 |       0.944 |     0.946 |   0.945 | 0.054 |
|     2 | indel |  1309 |   10 |  20 |       0.985 |     0.992 |   0.989 | 0.008 |
Pour essayer d'améliorer les statistiques :
- La version du génome GRC38 vs GRCh38.p13 ne change quasiment rien
- Désactiver dbSNP ne change strictement rien pour le variant calling
J'ai exploré les faux négatifs :
- la grande majorité n'est juste pas vue (ce n'est pas un problème d'haploïde/génotype)
- la répartition par chromosome est relativement homogène, sauf sur le 6 ()
- la majorité est en 5' et 3'UTR (selon Best refseq)
Conclusion: je pense m'arrêter là pour la validation du variant calling par manque de temps. Il faudrait creuser pour savoir pourquoi certains variants ne sont pas vus par GATK mais ce n'est pas la majorité. En tout cas, je peux justifier d'une première analyse pour la thèse.
Ça te va ?
[1]
https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-019-2928-9
Résultats ici https://static-content.springer.com/esm/art%3A10.1186%2Fs12859-019-2928-9/MediaObjects/12859_2019_2928_MOESM8_ESM.pdf
***** DONE Comparaison
CLOSED: [2023-03-04 Sat 11:14]
HGREF=/Work/Groups/bisonex/data-alexis-reference/genome/GRCh38_latest_genomic.fna ./result/bin/hap.py /Work/Groups/bisonex/NA12878/HG001_GRCh38_1_22_v4.2.1
_benchmark_renamed.vcf.gz script/files/vcf/NA12878_NIST7035_vep_annot.vcf -f /Work/Groups/bison
ex/NA12878/HG001_GRCh38_1_22_v4.2.1_benchmark.bed -o test
na1878.slurm
#+begin_src slurm
#!/bin/bash
#SBATCH -c 4
#SBATCH -p smp
#SBATCH --time=01:00:00
#SBATCH --mem=32G
module load nix/2.11.0
export HGREF=/Work/Groups/bisonex/data-alexis-reference/genome/GRCh38_latest_genomic.fna
dir=/Work/Groups/bisonex/data/NA12878/GRCh38
hap.py ${dir}/HG001_GRCh38_1_22_v4.2.1_benchmark.vcf.gz script/files/vcf/NA12878_NIST7035.vcf -f ${dir}/HG001_GRCh38_1_22_v4.2.1_benchmark.bed -o test
#+end_src
****** KILL beaucoup trop de faux négatifs
CLOSED: [2023-02-17 Fri 19:37]
******* DONE Test 1 : vep annot : beaucoup trop de faux négatif
CLOSED: [2023-02-06 lun. 13:40]
 Type Filter  TRUTH.TOTAL  TRUTH.TP  TRUTH.

[3.24607]

[2.8312]

/
On utilisé les données "trimmés" (https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-016-1069-7), i.e qui ont enlevé les fragments plus petits que la taille d'un read.
Informations:
- https://ftp-trace.ncbi.nih.gov/ReferenceSamples/giab/data/NA12878/Garvan_NA12878_HG001_HiSeq_Exome/Garvan_NA12878_HG001_HiSeq_Exome.README
- Sequencer: HiSeq2500
- kit: Nextera Rapid Capture Exome and Expanded Exome
Il y a 2 samples (NIST7035 et NIST7086), chacun sur 2 lanes -> à concaténer
NB : liste techno illumina https://www.illumina.com/systems/sequencing-platforms.html
Hiseq postérieur nextseq 550
******* TODO Fastq hiseq sans trimming
******* DONE Capture : Exons (bed)
CLOSED: [2023-02-25 Sat 19:46]
https://ftp-trace.ncbi.nih.gov/ReferenceSamples/giab/data/NA12878/Garvan_NA12878_HG001_HiSeq_Exome/nexterarapidcapture_expandedexome_targetedregions.bed.gz
******* DONE Bed, vcf
CLOSED: [2023-02-24 Fri 23:45]
****** DONE Ashkenazy trio HG002, HG003, HGQ004
CLOSED: [2023-04-06 Thu 21:43] SCHEDULED: <2023-04-01 Sat>
****** KILL Chinese trio HG005, 6, 7
CLOSED: [2023-04-16 Sun 16:32]
***** KILL Fastq :fastq:
CLOSED: [2023-04-16 Sun 16:32]
****** DONE NA12878 (HG001)
CLOSED: [2023-02-25 Sat 19:46]
******* DONE Fastq HiSeq
CLOSED: [2023-02-25 Sat 19:46]
On prend le Hiseq, qui est probablement ce qu'utilise Centogène :
https://ftp-trace.ncbi.nih.gov/ReferenceSamples/giab/data/NA12878/Garvan_NA12878_HG001_HiSeq_Exome/
On utilisé les données "trimmés" (https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-016-1069-7), i.e qui ont enlevé les fragments plus petits que la taille d'un read.
Informations:
- https://ftp-trace.ncbi.nih.gov/ReferenceSamples/giab/data/NA12878/Garvan_NA12878_HG001_HiSeq_Exome/Garvan_NA12878_HG001_HiSeq_Exome.README
- Sequencer: HiSeq2500
- kit: Nextera Rapid Capture Exome and Expanded Exome
Il y a 2 samples (NIST7035 et NIST7086), chacun sur 2 lanes -> à concaténer
NB : liste techno illumina https://www.illumina.com/systems/sequencing-platforms.html
Hiseq postérieur nextseq 550
******* DONE Capture : Exons (bed)
CLOSED: [2023-02-25 Sat 19:46]
https://ftp-trace.ncbi.nih.gov/ReferenceSamples/giab/data/NA12878/Garvan_NA12878_HG001_HiSeq_Exome/nexterarapidcapture_expandedexome_targetedregions.bed.gz
****** DONE Ashkenazy trio HG002, HG003, HG004
CLOSED: [2023-04-15 Sat 23:24] SCHEDULED: <2023-04-05 Wed>
******* DONE Capture
CLOSED: [2023-04-15 Sat 23:24]
https://ftp-trace.ncbi.nlm.nih.gov/giab/ftp/data/AshkenazimTrio/analysis/OsloUniversityHospital_Exome_GATK_jointVC_11242015/wex_Agilent_SureSelect_v05_b37.baits.slop50.merged.list
******* DONE Capture Agilent
CLOSED: [2023-04-15 Sat 23:24]
******* DONE Bam à partir des fastq
CLOSED: [2023-04-15 Sat 23:24]
Bam + index + checksum
https://raw.githubusercontent.com/genome-in-a-bottle/giab_data_indexes/master/AshkenazimTrio/alignment.index.AJtrio_OsloUniversityHospital_IlluminaExome_bwamem_GRCh37_11252015
****** KILL Chinese trio
CLOSED: [2023-04-16 Sun 16:32]
Whole exome pour HG005 seulement
******* KILL HG005
CLOSED: [2023-04-16 Sun 16:32]
https://raw.githubusercontent.com/genome-in-a-bottle/giab_data_indexes/master/ChineseTrio/alignment.index.Chinesetrio_HG005_OsloUniversityHospital_IlluminaExome_bwamem_GRCh37_11252015
**** TODO Télécharger FASTQ directement avec aws (via SRA)
SCHEDULED: <2023-06-27 Tue>
***** Remarques
Numéro d'accession : https://bmcgenomics.biomedcentral.com/articles/10.1186/s12864-022-08365-3/tables/1
Fastq disponible via SRA. Avec AWS, on peut accéder au fastq directement.
(Sinon il faut convertir SRA -> Fastq avec le toolkit : compliqué à configurer)
Exemple: https://trace.ncbi.nlm.nih.gov/Traces/?view=run_browser&acc=SRR2962669&display=data-access
Avantage:
- pas de conversion BAM -> fASTQ
- détail des capture
- capture en hg38 sur site du constructeur !!
- capture semblable pour ashkenazi
Inconvénient :
- NA12878 : discordance pour le nombre de paires de bases : NA12878 = 49G (donc 24G de fastq)
- capture non disponible en ligne (site agilent)
- format SRA (le lien pour les fastq n'est pas gratuit): utiliser HTTP ou leur toolkit (télécharge au format SRA puis convertit en fastq). Exemple: pour avoir 2 fastq 
  fastq-dump --split-files --gzip SRR2962669
***** Liste des runs :
https://www.ncbi.nlm.nih.gov/sra
Cherche avec numéro patient. On a le choix entre plusieurs séquenceurs Illumina
- NovaSeq 6000 TruSeq capture SRX11061536
- NovaSeq 6000 IDT capture SRX11061526
- NovaSeq 6000 Agilent SureSelect v7 capture SRX11061516
- HiSeq 4000 TruSeq capture SRX11061506
- HiSeq 4000 IDT capture SRX11061496
- HiSeq 4000 Agilent SureSelect v7 capture SRX11061486
Note: SRX = expérience, SRR = run
          Important:
          - ne pas compresser la sortie avec fasta-dump directement (lent++)
          - Fasterq-dump est plus rapide
          
  Note trueseq non disponible ?
  hg19 : https://www.biostars.org/p/144554/
IDT: lequel
https://www.idtdna.com/pages/products/next-generation-sequencing/workflow/xgen-ngs-hybridization-capture/pre-designed-hyb-cap-panels/exome-hyb-panel-v2
***** DONE HiSeq 4000 + agilent sureselect :sra:
CLOSED: [2023-06-28 Wed 22:06] SCHEDULED: <2023-06-28 Wed>
        - [ ] HG001 with Illumina HiSeq 4000 Agilent SureSelect v7 capture SRX11061486 SRR14724513	
        - [ ] HG002 with Illumina HiSeq 4000 Agilent SureSelect v7 capture SRX11061487 SRR14724512
        - [ ] HG003 with Illumina HiSeq 4000 Agilent SureSelect v7 capture SRX11061488 SRR14724511
        - [ ] HG004 with Illumina HiSeq 4000 Agilent SureSelect v7 capture SRX11061489 SRR14724510
          
        Other
 - HG005 with Illumina HiSeq 4000 Agilent SureSelect v7 capture SRX11061491 SRR14724508
           - HG006 with Illumina HiSeq 4000 Agilent SureSelect v7 capture SRX11061492 SRR14724507
           - HG007 with Illumina HiSeq 4000 Agilent SureSelect v7 capture SRX11061493 SRR14724506
******* TODO Capture agilent sureselect
SCHEDULED: <2023-06-28 Wed>
**** TODO NA12878 :na12878:hg38:
***** DONE Discussion alexis : Mail
CLOSED: [2023-03-29 Wed 22:40]
Avec le patient NA12878 et comparaison avec hap.py du VCF de Genome In A Bottle ("gold" standard), on avait pour rappel
- sensibilité (=recall) 71% pour indel, 85% SNP
- précision  (= VPP) 69 et 97% respectivement
| Type  | TRUTH |    TP |   FN | QUERY |   FP |  UNK | FP.gt | FP.al |   Recall | Precision |
| INDEL |  4871 |  3461 | 1410 |  7048 | 1554 | 1987 |   193 |   346 | 0.710532 |  0.692946 |
| SNP   | 46032 | 39369 | 6663 | 44600 | 1186 | 4041 |   304 |    30 | 0.855253 |  0.970759 |
Les statistiques sur les génomes sont bien meilleurs (cf precisionFDA challenge).
Pour les exome, un article [1] a fait a des meilleures stats sur ce patient avec BWA et GATK mais ils ont moins de variant (on a presque un facteur 2 !).
Je soupçonne qu'on ne travaille pas sur les mêmes zones de capture (pas réussi à récupérer leur .bed)
| Exome | Type  |    TP |   FP |  FN | Sensitivity | Precision | F-Score |   FDR |
|     1 | SNV   | 23689 | 1397 | 613 |       0.975 |     0.944 |   0.959 | 0.057 |
|     2 | SNV   | 23946 |  865 | 356 |       0.985 |     0.965 |   0.975 | 0.036 |
|     1 | indel |  1254 |   72 |  75 |       0.944 |     0.946 |   0.945 | 0.054 |
|     2 | indel |  1309 |   10 |  20 |       0.985 |     0.992 |   0.989 | 0.008 |
Pour essayer d'améliorer les statistiques :
- La version du génome GRC38 vs GRCh38.p13 ne change quasiment rien
- Désactiver dbSNP ne change strictement rien pour le variant calling
J'ai exploré les faux négatifs :
- la grande majorité n'est juste pas vue (ce n'est pas un problème d'haploïde/génotype)
- la répartition par chromosome est relativement homogène, sauf sur le 6 ()
- la majorité est en 5' et 3'UTR (selon Best refseq)
Conclusion: je pense m'arrêter là pour la validation du variant calling par manque de temps. Il faudrait creuser pour savoir pourquoi certains variants ne sont pas vus par GATK mais ce n'est pas la majorité. En tout cas, je peux justifier d'une première analyse pour la thèse.
Ça te va ?
[1]
https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-019-2928-9
Résultats ici https://static-content.springer.com/esm/art%3A10.1186%2Fs12859-019-2928-9/MediaObjects/12859_2019_2928_MOESM8_ESM.pdf
***** DONE Comparaison
CLOSED: [2023-03-04 Sat 11:14]
HGREF=/Work/Groups/bisonex/data-alexis-reference/genome/GRCh38_latest_genomic.fna ./result/bin/hap.py /Work/Groups/bisonex/NA12878/HG001_GRCh38_1_22_v4.2.1
_benchmark_renamed.vcf.gz script/files/vcf/NA12878_NIST7035_vep_annot.vcf -f /Work/Groups/bison
ex/NA12878/HG001_GRCh38_1_22_v4.2.1_benchmark.bed -o test
na1878.slurm
#+begin_src slurm
#!/bin/bash
#SBATCH -c 4
#SBATCH -p smp
#SBATCH --time=01:00:00
#SBATCH --mem=32G
module load nix/2.11.0
export HGREF=/Work/Groups/bisonex/data-alexis-reference/genome/GRCh38_latest_genomic.fna
dir=/Work/Groups/bisonex/data/NA12878/GRCh38
hap.py ${dir}/HG001_GRCh38_1_22_v4.2.1_benchmark.vcf.gz script/files/vcf/NA12878_NIST7035.vcf -f ${dir}/HG001_GRCh38_1_22_v4.2.1_benchmark.bed -o test
#+end_src
****** KILL beaucoup trop de faux négatifs
CLOSED: [2023-02-17 Fri 19:37]
******* DONE Test 1 : vep annot : beaucoup trop de faux négatif
CLOSED: [2023-02-06 lun. 13:40]
 Type Filter  TRUTH.TOTAL  TRUTH.TP  TRUTH.

Replacement in projects/bisonex.org at line 38 [4.35]

B:BD[5.5956] → [5.5956:7460]

B:BD[5.7460] → [3.34056:56478]

∅:D[3.56478] → [6.20953:21603]

B:BD[6.20953] → [6.20953:21603]

ty | F-measure |
|-----------+-------------------+---------------+-----------+-----------+-----------+-------------+-----------|
| 3.000     |             42789 |         42416 |      2598 |      8080 |    0.9423 |      0.8412 |    0.8889 |
| None      |             42798 |         42425 |      2616 |      8071 |    0.9419 |      0.8413 |    0.8888 |
Indel avec le plus petit seuil : zcat NA12878.non_snp_roc.tsv.gz
Attention à inverser precision et recall !
 zcat NA12878.non_snp_roc.tsv.gz  | tail -n 1 | awk '{print $7 $6}'
0.71390.7136
SNP avec le plus petit seuil : zcat NA12878.non_snp_roc.tsv.gz
Attention à inverser precision et recall !
$ zcat NA12878.snp_roc.tsv.gz  | tail -n 1 | awk '{print $7 $6}'
0.85470.9727
compareNA12878-giab/vcfeval/NA12878.summary.txt
| Threshold | True-pos-baseline | True-pos-call | False-pos | False-neg | Precision | Sensitivity | F-measure |
| 1.000     |             44812 |         44812 |      2878 |      6057 |    0.9397 |      0.8809 |    0.9093 |
| None      |             44813 |         44813 |      2882 |      6056 |    0.9396 |      0.8809 |    0.9093 |
SNP:
$ zcat NA12878.snp_roc.tsv.gz  | tail -n 1 | awk '{print $7 $6}'
0.89370.9621
indel
$ zcat NA12878.non_snp_roc.tsv.gz  | tail -n 1 | awk '{print $7 $6}'
0.75980.7445
compareNA12878-giab/happy/NA12878.summary.csv
| Type  | Filter | TRUTH.TOTAL | TRUTH.TP | TRUTH.FN | QUERY.TOTAL | QUERY.FP | QUERY.UNK | FP.gt | FP.al | METRIC.Recall | METRIC.Precision
 | METRIC.Frac_NA | METRIC.F1_Score | TRUTH.TOTAL.TiTv_ratio | QUERY.TOTAL.TiTv_ratio | TRUTH.TOTAL.het_hom_ratio | QUERY.TOTAL.het_hom_ratio |
|-------+--------+-------------+----------+----------+-------------+----------+-----------+-------+-------+---------------+------------------+----------------+-----------------+------------------------+------------------------+---------------------------+---------------------------|
| INDEL | ALL    |        4871 |     3678 |     1193 |        7036 |     1299 |      2011 |   208 |   217 |      0.755081 |         0.741493 |       0.285816 |        0.748225 |                        |                        |        1.6174985978687606 |        2.5240506329113925 |
| INDEL | PASS   |        4871 |     3678 |     1193 |        7036 |     1299 |      2011 |   208 |   217 |      0.755081 |         0.741493 |       0.285816 |        0.748225 |                        |                        |        1.6174985978687606 |        2.5240506329113925 |
| SNP   | ALL    |       46032 |    41138 |     4894 |       47694 |     1622 |      4930 |   362 |    31 |      0.893683 |         0.962071 |       0.103367 |        0.926617 |      2.529551552318896 |     2.4124463519313304 |        1.6206857273037931 |        1.6888675840288743 |
| SNP   | PASS   |       46032 |    41138 |     4894 |       47694 |     1622 |      4930 |   362 |    31 |      0.893683 |         0.962071 |       0.103367 |        0.926617 |      2.529551552318896 |     2.4124463519313304 |        1.6206857273037931 |         1.688867584028874 |
***** KILL Résultats sans trimming
CLOSED: [2023-06-25 Sun 15:53] SCHEDULED: <2023-06-26 Mon>
***** TODO Refaire avec génome "prêt à l'emploi"
SCHEDULED: <2023-06-25 Sun>
***** KILL Utiliser d'autres données brutes ?
CLOSED: [2023-06-25 Sun 15:58]
https://zenodo.org/record/3597727
Capture en hg37 également. Serait intéressant mais pas le temps..
***** KILL Comparer avec UCSCS liftover
CLOSED: [2023-06-26 Mon 19:02] SCHEDULED: <2023-06-25 Sun>
Picard liftoverinterval est basé sur UCSCS
Mais on n'aurait pas la différence pour NA12878 qu'on voit...
**** TODO HG002 :hg002:hg38:
SCHEDULED: <2023-04-10 Mon>
#+begin_src
    NXF_OPTS=-D"user.name=${USER}" nextflow run workflows/giabFastq.nf -profile standard,helios
    NXF_OPTS=-D"user.name=${USER}" nextflow run main.nf -profile standard,helios -resume --input="/Work/Groups/bisonex/data/giab/GRCh38/HG002_{1,2}.fq.gz --test.id=HG002
Only the capture file differs. Results are better using the capture file given by Agilent, stored in data/
    NXF_OPTS=-D"user.name=${USER}" nextflow run workflows/compareVCF.nf -profile standard,helios -resume --outdir=compareHG002 --test.id=HG002 --test.query=out/HG002_1/variantCalling/haplotypecaller/HG002_1.vcf.gz  --test.compare=vcfeval,happy --test.capture=data/AgilentSureSelectv05_hg38.bed
#
#+end_src
***** DONE Mauvais résultats
CLOSED: [2023-04-14 Fri 09:42]
avec vcfeval
Threshold  True-pos-baseline  True-pos-call  False-pos  False-neg  Precision  Sensitivity  F-measure
----------------------------------------------------------------------------------------------------
    0.000              24585          24390      10060      39415     0.7080       0.3841     0.4980
     None              24585          24390      10060      39415     0.7080       0.3841     0.4980
La sortie du variantCalling est celle d'happy ???
On relance...
***** DONE Vérifier vcf en hg38
CLOSED: [2023-04-12 Wed 10:33] SCHEDULED: <2023-04-12 Wed>
***** KILL Capture en hg19 ?
CLOSED: [2023-04-13 Thu 09:46] SCHEDULED: <2023-04-12 Wed>
***** KILL Vraiment fichier de capture ou zone d'intérêt ?
CLOSED: [2023-04-13 Thu 09:45] SCHEDULED: <2023-04-12 Wed>
"target region" +/- 50bp
[[https://ftp-trace.ncbi.nlm.nih.gov/ReferenceSamples/giab/data/AshkenazimTrio/analysis/OsloUniversityHospital_Exome_GATK_jointVC_11242015/README.txt][README]]
 list file describing the variant calling regions (target regions extended with 50 bp on each end)
***** DONE .bed fourni par AGilent: sensbilité très mauvaise
CLOSED: [2023-04-13 Thu 09:46] SCHEDULED: <2023-04-13 Thu>
Agilent SureSelect Human All Exon V5 kit
Disponible en hg38
Threshold  True-pos-baseline  True-pos-call  False-pos  False-neg  Precision  Sensitivity  F-measure
----------------------------------------------------------------------------------------------------
    0.000              19653          19501       6410      21657     0.7526       0.4757     0.5830
     None              19653          19501       6410      21657     0.7526       0.4757     0.5830
***** DONE Trier par nom avec samtools sort : bons résultats
CLOSED: [2023-04-14 Fri 09:25] SCHEDULED: <2023-04-13 Thu>
Avec capture fourni par GIAB
vcf eval
Threshold  True-pos-baseline  True-pos-call  False-pos  False-neg  Precision  Sensitivity  F-measure
----------------------------------------------------------------------------------------------------
    5.000              57443          57032        984       6557     0.9830       0.8975     0.9383
     None              57457          57046       1009       6543     0.9826       0.8978     0.9383
Happy
| Type  | Filter | TRUTH.TOTAL | TRUTH.TP | TRUTH.FN | QUERY.TOTAL | QUERY.FP | QUERY.UNK | FP.gt | FP.al | METRIC.Recall | METRIC.Precision | METRIC.Frac_NA | METRIC.F1_Score | TRUTH.TOTAL.TiTv_ratio | QUERY.TOTAL.TiTv_ratio | TRUTH.TOTAL.het_hom_ratio | QUERY.TOTAL.het_hom_ratio |
|-------+--------+-------------+----------+----------+-------------+----------+-----------+-------+-------+---------------+------------------+----------------+-----------------+------------------------+------------------------+---------------------------+---------------------------|
| INDEL | ALL    |        6150 |     5007 |     1143 |        6978 |      556 |      1346 |   151 |   168 |      0.814146 |         0.901278 |       0.192892 |          0.8555 |                        |                        |        1.5434221840068787 |        1.9467178175618074 |
| INDEL | PASS   |        6150 |     5007 |     1143 |        6978 |      556 |      1346 |   151 |   168 |      0.814146 |         0.901278 |       0.192892 |          0.8555 |                        |                        |        1.5434221840068787 |        1.9467178175618074 |
| SNP   | ALL    |       57818 |    52464 |     5354 |       56016 |      500 |      3046 |    90 |    30 |      0.907399 |         0.990561 |       0.054377 |        0.947158 |     2.4892012548262548 |      2.426824047458871 |        1.5904527117884357 |        1.6107795598657217 |
| SNP   | PASS   |       57818 |    52464 |     5354 |       56016 |      500 |      3046 |    90 |    30 |      0.907399 |         0.990561 |       0.054377 |        0.947158 |     2.4892012548262548 |      2.426824047458871 |        1.5904527117884357 |        1.6107795598657217 |
***** DONE Capture agilent légment meilleur que celui fourni par GIAB (padding ?)
CLOSED: [2023-04-14 Fri 09:48]
GIAB:
vcf eval
Threshold  True-pos-baseline  True-pos-call  False-pos  False-neg  Precision  Sensitivity  F-measure
----------------------------------------------------------------------------------------------------
    5.000              57443          57032        984       6557     0.9830       0.8975     0.9383
     None              57457          57046       1009       6543     0.9826       0.8978     0.9383
Happy
| Type  | Filter | TRUTH.TOTAL | TRUTH.TP | TRUTH.FN | QUERY.TOTAL | QUERY.FP | QUERY.UNK | FP.gt | FP.al | METRIC.Recall | METRIC.Precision | METRIC.Frac_NA | METRIC.F1_Score | TRUTH.TOTAL.TiTv_ratio | QUERY.TOTAL.TiTv_ratio | TRUTH.TOTAL.het_hom_ratio | QUERY.TOTAL.het_hom_ratio |
|-------+--------+-------------+----------+----------+-------------+----------+-----------+-------+-------+---------------+------------------+----------------+-----------------+------------------------+------------------------+---------------------------+---------------------------|
| INDEL | ALL    |        6150 |     5007 |     1143 |        6978 |      556 |      1346 |   151 |   168 |      0.814146 |         0.901278 |       0.192892 |          0.8555 |                        |                        |        1.5434221840068787 |        1.9467178175618074 |
| INDEL | PASS   |        6150 |     5007 |     1143 |        6978 |      556 |      1346 |   151 |   168 |      0.814146 |         0.901278 |       0.192892 |          0.8555 |                        |                        |        1.5434221840068787 |        1.9467178175618074 |
| SNP   | ALL    |       57818 |    52464 |     5354 |       56016 |      500 |      3046 |    90 |    30 |      0.907399 |         0.990561 |       0.054377 |        0.947158 |     2.4892012548262548 |      2.426824047458871 |        1.5904527117884357 |        1.6107795598657217 |
| SNP   | PASS   |       57818 |    52464 |     5354 |       56016 |      500 |      3046 |    90 |    30 |      0.907399 |         0.990561 |       0.054377 |        0.947158 |     2.4892012548262548 |      2.426824047458871 |        1.5904527117884357 |        1.6107795598657217 |
Agilent
Threshold  True-pos-baseline  True-pos-call  False-pos  False-neg  Precision  Sensitivity  F-measure
----------------------------------------------------------------------------------------------------
    6.000              37241          36965        449       4069     0.9880       0.9015     0.9428
     None              37248          36972        461       4062     0.9877       0.9017     0.9427
| Type  | Filter | TRUTH.TOTAL | TRUTH.TP | TRUTH.FN | QUERY.TOTAL | QUERY.FP | QUERY.UNK | FP.gt | FP.al | METRIC.Recall | METRIC.Precision | METRIC.Frac_NA | METRIC.F1_Score | TRUTH.TOTAL.TiTv_ratio | QUERY.TOTAL.TiTv_ratio | TRUTH.TOTAL.het_hom_ratio | QUERY.TOTAL.het_hom_ratio |
| INDEL | ALL    |        2909 |     2477 |      432 |        3229 |      207 |       519 |    52 |    50 |      0.851495 |         0.923616 |       0.160731 |        0.886091 |                        |                        |        1.4964850615114236 |        1.8339222614840989 |
| INDEL | PASS   |        2909 |     2477 |      432 |        3229 |      207 |       519 |    52 |    50 |      0.851495 |         0.923616 |       0.160731 |        0.886091 |                        |                        |        1.4964850615114236 |        1.8339222614840989 |
| SNP   | ALL    |       38406 |    34793 |     3613 |       36935 |      275 |      1868 |    37 |    15 |      0.905926 |         0.992158 |       0.050575 |        0.947083 |     2.6247759222568168 |     2.5752854654538417 |         1.588953331534934 |        1.6192536889897844 |
| SNP   | PASS   |       38406 |    34793 |     3613 |       36935 |      275 |      1868 |    37 |    15 |      0.905926 |         0.992158 |       0.050575 |        0.947083 |     2.6247759222568168 |     2.5752854654538417 |         1.588953331534934 |        1.6192536889897844 |
***** TODO Refaire avec génome "prêt à l'emploi"
SCHEDULED: <2023-06-25 Sun>
**** TODO HG003 :hg003:hg38:
***** Notes
#+begin_src sh
NXF_OPTS=-D"user.name=${USER}" nextflow run main.nf -profile standard,helios  --input /Work/Groups/bisonex/data/giab/GRCh38/HG003_{1,2}.fq.gz -bg
#+end_src
#+begin_src  sh
NXF_OPTS=-D"user.name=${USER}" nextflow run workflows/compareVCF.nf -profile standard,helios -resume --outdir=compareHG003  --test.id=HG003 --test.query=out/HG003_1/variantCalling/haplotypecaller/HG003_1.vcf.gz  --test.compare=vcfeval,happy --test.capture=data/AgilentSureSelectv05_hg38.bed
#+end_src
vcfeval
Threshold  True-pos-baseline  True-pos-call  False-pos  False-neg  Precision  Sensitivity  F-measure
----------------------------------------------------------------------------------------------------
    5.000              36745          36473        486       3988     0.9869       0.9021     0.9426
     None              36748          36476        495       3985     0.9866       0.9022     0.9425
$ zcat NA12878.snp_roc.tsv.gz  | tail -n 1 | awk '{print $7 $6}'
happy
Type Filter  TRUTH.TOTAL  TRUTH.TP  TRUTH.FN  QUERY.TOTAL  QUERY.FP  QUERY.UNK  FP.gt  FP.al  METRIC.Recall  METRIC.Precision  METRIC.Frac_NA  METRIC.F1_Score  TRUTH.TOTAL.TiTv_ratio  QUERY.TOTAL.TiTv_ratio  TRUTH.TOTAL.het_hom_ratio  QUERY.TOTAL.het_hom_ratio
INDEL    ALL         2731      2290       441         3092       208        577     62     53       0.838521          0.917296        0.186611         0.876141                     NaN                     NaN                   1.505145                   1.888993
INDEL   PASS         2731      2290       441         3092       208        577     62     53       0.838521          0.917296        0.186611         0.876141                     NaN                     NaN                   1.505145                   1.888993
  SNP    ALL        37997     34481      3516        36861       306       2074     33     13       0.907466          0.991204        0.056265         0.947488                2.611269                2.565915                   1.555780                   1.621727
  SNP   PASS        37997     34481      3516        36861       306       2074     33     13       0.907466          0.991204        0.056265         0.947488                2.611269                2.5659
***** TODO Refaire avec génome "prêt à l'emploi"
SCHEDULED: <2023-06-25 Sun>
**** TODO HG004 :hg38:
#+begin_src sh
NXF_OPTS=-D"user.name=${USER}" nextflow run main.nf -profile standard,helios  --input /Work/Groups/bisonex/data/giab/GRCh38/HG004_{1,2}.fq.gz -bg
#+end_src
vcfeval
Threshold  True-pos-baseline  True-pos-call  False-pos  False-neg  Precision  Sensitivity  F-measure
----------------------------------------------------------------------------------------------------
    6.000              36938          36678        421       4040     0.9887       0.9014     0.9430
     None              36942          36682        432       4036     0.9884       0.9015     0.9429
happy
 Type Filter  TRUTH.TOTAL  TRUTH.TP  TRUTH.FN  QUERY.TOTAL  QUERY.FP  QUERY.UNK  FP.gt  FP.al  METRIC.Recall  METRIC.Precision  METRIC.Frac_NA  METRIC.F1_Score  TRUTH.TOTAL.TiTv_ratio  QUERY.TOTAL.TiTv_ratio  TRUTH.TOTAL.het_hom_ratio  QUERY.TOTAL.het_hom_ratio
INDEL    ALL         2787      2388       399         3183       195        580     53     38       0.856835          0.925086        0.182218         0.889654                     NaN                     NaN                   1.507834                   1.848649
INDEL   PASS         2787      2388       399         3183       195        580     53     38       0.856835          0.925086        0.182218         0.889654                     NaN                     NaN                   1.507834                   1.848649
  SNP    ALL        38185     34560      3625        36921       254       2107     46      7       0.905067          0.992704        0.057068         0.946862                2.589175                2.553546                   1.632595                   1.653534
  SNP   PASS        38185     34560      3625        36921       254       2107     46      7       0.905067          0.992704        0.057068         0.946862                2.589175                2.553546                   1.632595                   1.653534
**** DONE Résumer résultats pour Paul + article :resultats:hg38:
CLOSED: [2023-04-06 Thu 21:41] SCHEDULED: <2023-04-02 Sun>
**** DONE Plot : ashkenazim trio :hg38:
CLOSED: [2023-04-18 Tue 21:27] SCHEDULED: <2023-04-16 Sun>
/Entered on/ [2023-04-16 Sun 17:29]
**** TODO Refaire avec génome "prêt  l'emploi"
SCHEDULED: <2023-06-25 Sun>
**** TODO NA12878 :na12878:T2T:
SCHEDULED: <2023-06-15 Thu>
*** KILL Platinum genome
CLOSED: [2023-06-14 Wed 22:37]
https://emea.illumina.com/platinumgenomes.html
*** TODO Séquencer NA12878
Discussion avec Paul : sous-traitant ne nous donnera pas les données, il faut commander l'ADN
** TODO Insilico :centogene:
*** TODO tous les variants centogène
**** DONE Extraire liste des SNVs
CLOSED: [2023-04-22 Sat 17:32] SCHEDULED: <2023-04-17 Mon>
***** DONE Corriger manquant à la main
CLOSED: [2023-04-22 Sat 17:31]
La sortie est sauvegardé dans git-annex : variants_success.csv
***** DONE Automatique
CLOSED: [2023-04-22 Sat 17:31]
**** DONE Convert SNVs : transcript -> génomique
CLOSED: [2023-06-03 Sat 17:16]
***** DONE Variant_recoder
CLOSED: [2023-04-26 Wed 21:21] SCHEDULED: <2023-04-22 Sat>
****** KILL Haskell: 160 manquant : recoded-success.csv
CLOSED: [2023-04-25 Tue 18:32]
La liste des variants a été générée en Haskel   l et nettoyée à la main.
On générer une liste de variant pour variant_rec            oder et on soumet tout d'un coup.
[[file:~/recherche/bisonex/parsevariants/app/Main.hs][parsevariant]]
#+begin_src haskell
recodeVariant = do
  prepareVariantRecod   er "variant_success.csv" "renamed.csv"
  runVariantRecoder "renamed.csv" "recoded.json"
#+end_src
#+RESULTS:
: <interactive>:4:3-19: error:
:     Variable not in scope: runVariantRecoder :: String -> String -> t
: gh
Problème : 160 n'ont pas pu être lu sur 820, probablement à cause du numéro mineur de transcrit
La sortie est sauvegardé dans git-annex : variants-recoded-raw.json.
****** KILL Julia
CLOSED: [2023-04-25 Tue 18:32]
On regénère la liste de variant et on passe à Julia pour préparer l'appel en parallèle à variant recoder
[[file:~/recherche/bisonex/parsevariants/variantRecoder.jl][variantRecoder.jl]]
#+begin_src julia
setupVariantRecoder(unique(init), n)
#+end_src
Puis
#+begin_src sh
parallel -a parallel-recoder.sh --jobs 10
#+end_src
On récupère les résultats
#+begin_src julia
(fails, success) = mergeVariantRecoder(n)
CSV.write(fSuccess, success)
CSV.write(fFailures, fails)
#+end_src
Certains variants ne sont pas trouvé, donc on prépare un nouveau job en enlevant les versionrs mineures des transcrits
#+begin_src julia
# Cleanup json and txt
if isfile(fSuccess) && isfile(fFailures)
    foreach(rm, variantRecoderInput())
    foreach(rm, variantRecoderOutput())
end
redoFails(fFailures)
#+end_src
Puis
#+begin_src sh
parallel -a parallel-recoder.sh --jobs 3
#+end_src
Il manque encore 70 transcrits
***** DONE Julia avec mobidetails: recode-failures-mobidetails.csv
CLOSED: [2023-04-25 Tue 18:58]
Nouvelle stratégie : on essaie une fois variant recoder.
Pour tous les échecs, on utilise mobidetails (~170).
Si l'ID n'est pas trouvé, on incrémente le numéro de version 2 fois
***** DONE Reste une dizaine à corriger à la main
CLOSED: [2023-04-26 Wed 21:21]
- [X] certains transcrits ont juste été supprimé
- [X] Erreur de parsing, manque souvent un -
#+begin_src julia
lastTryMobidetails("recoded-failures-mobidetails.csv")
#+end_src
***** DONE Fusionner données
CLOSED: [2023-04-26 Wed 22:35]
#+begin_src julia
function mergeAllGenomic()
    dNew = mergeAll("recoded-success.csv",
                    "recoded-failures-mobidetails.csv",
                    "recoded-failures-mobidetails-redo.csv")
    dInit = @chain DataFrame(CSV.File("variant_success.csv")) begin
        @transform :transcript = :transcript .* ":" .* :coding .* :codingPos .* :codingChange
        @select :file :transcript :classification :zygosity
        @rename :classificationCentogene = :classification
    end
    dTmp = outerjoin(dInit, dNew, on = :transcript)
    CSV.write("variant_genomic.csv", dTmp)
end
fSuccess = "recoded-success.csv"
fFailures = "recoded-failures.csv"
# variantRecoder(fSuccess, fFailures)
# mobidetailsOnFailures(fFailures)
# lastTryMobidetails("recoded-failures-mobidetails.csv")
mergeAllGenomic()
#+end_src
***** DONE Formatter donner pour simuscop
CLOSED: [2023-04-28 Fri 11:55] SCHEDULED: <2023-04-26 Wed>
**** TODO Extraire liste des CNVs
SCHEDULED: <2023-04-17 Mon>
**** TODO Simuscop :simuscop:
***** DONE Entrainer le modèle sur 63003856/
CLOSED: [2023-04-29 Sat 19:56]
Relancer le modèle pour être sûr
***** DONE Générer fastq avec simuscop (del et ins seulement) 20x
CLOSED: [2023-04-28 Fri 23:35] SCHEDULED: <2023-04-22 Sat>
****** DONE Génerer un profile avec bed de centogène
CLOSED: [2023-04-28 Fri 11:54] SCHEDULED: <2023-04-22 Sat>
NA12878 mais à refaire avec un vrai séquencage
Voir [[*Centogène][Bed Centogène]] pour choix
****** DONE Générer les données en 20x
CLOSED: [2023-04-28 Fri 11:54] SCHEDULED: <2023-04-22 Sat>
capture de centogene
****** DONE Regénérer en supprimant les doublons
CLOSED: [2023-04-28 Fri 17:28]
***** DONE Quelle couverture ?
CLOSED: [2023-04-29 Sat 18:26]
ex sur chr11:16,014,966 où on a 11 reads dans la simulation contre 200 !
****** 200 est la plus proche
#+attr_html: :width 500px
[[./simuscop-200-chr1-1.png]]
#+attr_html: :width 500px
[[./simuscop-200-chr1-2.png]]
****** DONE 20x
CLOSED: [2023-04-29 Sat 15:38]
****** DONE 50x
CLOSED: [2023-04-29 Sat 15:38]
****** DONE 100x
CLOSED: [2023-04-29 Sat 15:39]
****** DONE 200x
CLOSED: [2023-04-29 Sat 15:39]
***** DONE Reads mal centrés sur des petits exons seuls
CLOSED: [2023-04-29 Sat 19:56] SCHEDULED: <2023-04-29 Sat>
Capture ok : [[https://genome-euro.ucsc.edu/cgi-bin/hgTracks?db=hg38&lastVirtModeType=default&lastVirtModeExtraState=&virtModeType=default&virtMode=0&nonVirtPosition=&position=chr1%3A153817168%2D153817824&hgsid=296556270_F4fkENLPXHXidi2oALXls2jxNH9l][UCSC]] (track noire)
Mais mauvaise répartitiopn
#+attr_html: :width 800px
[[./simuscop-error.png]]
À tester
- Problème de profile ?
  - mauvais patient ?
  - mauvaise génération ? -> comparer avec ceux donnés sur github
- nom des chromosomes ?
****** DONE [#A] Tester sur exon 6 GATAD2B pour NC_000001.11:g.153817496A>T
CLOSED: [2023-04-29 Sat 19:56] SCHEDULED: <2023-04-29 Sat>
******* DONE Configuration + Profile 63003856.profile: idem, mal centré
CLOSED: [2023-04-29 Sat 19:18]
Téléchargement des données
#+begin_src sh :dir ~/code/bisonex/test-simuscop
scp meso:/Work/Projects/bisonex/data/genome/GRCh38.p14/genomeRef.fna .
scp meso:Work/Projects/bisonex/data/simuscop/*.profile .
scp -r meso:/Work/Projects/bisonex/data/genome/GRCh38.p13/bwa .
#+end_src
On récupère l'exon (NB: org
-mode ne lance pas le code...)
#+begin_src julia
using CSV,DataFramesMeta
d = CSV.read("VCGS_Exome_Covered_Targets_hg38_40.1MB_renamed.bed", header=false, delim="\t", DataFrame)
@subset d :Column1 .== "NC_000001.11" :Column2 .<= 153817496 :Column3 .>= 153817496
#+end_src
NC_000001.11  153817371  153817542
Génération du bed
#+begin_src sh :dir ~/code/bisonex/test-simuscop
echo -e "NC_000001.11\t153817371\t153817542" > gatad2b-exon6.bed
#+end_src
#+RESULTS:
Génération d'un variant
#+begin_src sh :dir ~/code/bisonex/test-simuscop
echo -e "s\tsingle\tNC_000001.11\t153817496\tA\tT\thet"> variant.txt
#+end_src
#+RESULT

[5.5956]

[6.21603]

ty | F-measure |
|-----------+-------------------+---------------+-----------+-----------+-----------+-------------+-----------|
| 3.000     |             42789 |         42416 |      2598 |      8080 |    0.9423 |      0.8412 |    0.8889 |
| None      |             42798 |         42425 |      2616 |      8071 |    0.9419 |      0.8413 |    0.8888 |
Indel avec le plus petit seuil : zcat NA12878.non_snp_roc.tsv.gz
Attention à inverser precision et recall !
 zcat NA12878.non_snp_roc.tsv.gz  | tail -n 1 | awk '{print $7 $6}'
0.71390.7136
SNP avec le plus petit seuil : zcat NA12878.non_snp_roc.tsv.gz
Attention à inverser precision et recall !
$ zcat NA12878.snp_roc.tsv.gz  | tail -n 1 | awk '{print $7 $6}'
0.85470.9727
compareNA12878-giab/vcfeval/NA12878.summary.txt
| Threshold | True-pos-baseline | True-pos-call | False-pos | False-neg | Precision | Sensitivity | F-measure |
| 1.000     |             44812 |         44812 |      2878 |      6057 |    0.9397 |      0.8809 |    0.9093 |
| None      |             44813 |         44813 |      2882 |      6056 |    0.9396 |      0.8809 |    0.9093 |
SNP:
$ zcat NA12878.snp_roc.tsv.gz  | tail -n 1 | awk '{print $7 $6}'
0.89370.9621
indel
$ zcat NA12878.non_snp_roc.tsv.gz  | tail -n 1 | awk '{print $7 $6}'
0.75980.7445
compareNA12878-giab/happy/NA12878.summary.csv
| Type  | Filter | TRUTH.TOTAL | TRUTH.TP | TRUTH.FN | QUERY.TOTAL | QUERY.FP | QUERY.UNK | FP.gt | FP.al | METRIC.Recall | METRIC.Precision | METRIC.Frac_NA | METRIC.F1_Score | TRUTH.TOTAL.TiTv_ratio | QUERY.TOTAL.TiTv_ratio | TRUTH.TOTAL.het_hom_ratio | QUERY.TOTAL.het_hom_ratio |
|-------+--------+-------------+----------+----------+-------------+----------+-----------+-------+-------+---------------+------------------+----------------+-----------------+------------------------+------------------------+---------------------------+---------------------------|
| INDEL | ALL    |        4871 |     3678 |     1193 |        7036 |     1299 |      2011 |   208 |   217 |      0.755081 |         0.741493 |       0.285816 |        0.748225 |                        |                        |        1.6174985978687606 |        2.5240506329113925 |
| INDEL | PASS   |        4871 |     3678 |     1193 |        7036 |     1299 |      2011 |   208 |   217 |      0.755081 |         0.741493 |       0.285816 |        0.748225 |                        |                        |        1.6174985978687606 |        2.5240506329113925 |
| SNP   | ALL    |       46032 |    41138 |     4894 |       47694 |     1622 |      4930 |   362 |    31 |      0.893683 |         0.962071 |       0.103367 |        0.926617 |      2.529551552318896 |     2.4124463519313304 |        1.6206857273037931 |        1.6888675840288743 |
| SNP   | PASS   |       46032 |    41138 |     4894 |       47694 |     1622 |      4930 |   362 |    31 |      0.893683 |         0.962071 |       0.103367 |        0.926617 |      2.529551552318896 |     2.4124463519313304 |        1.6206857273037931 |         1.688867584028874 |
***** KILL Résultats sans trimming
CLOSED: [2023-06-25 Sun 15:53] SCHEDULED: <2023-06-26 Mon>
***** TODO Refaire : HiSeq4000 + agilent sureselect + génome "prêt à l'emploi"
SCHEDULED: <2023-06-25 Sun>
***** KILL Utiliser d'autres données brutes ?
CLOSED: [2023-06-25 Sun 15:58]
https://zenodo.org/record/3597727
Capture en hg37 également. Serait intéressant mais pas le temps..
***** KILL Comparer avec UCSCS liftover
CLOSED: [2023-06-26 Mon 19:02] SCHEDULED: <2023-06-25 Sun>
Picard liftoverinterval est basé sur UCSCS
Mais on n'aurait pas la différence pour NA12878 qu'on voit...
**** TODO HG002 :hg002:hg38:
SCHEDULED: <2023-04-10 Mon>
#+begin_src
    NXF_OPTS=-D"user.name=${USER}" nextflow run workflows/giabFastq.nf -profile standard,helios
    NXF_OPTS=-D"user.name=${USER}" nextflow run main.nf -profile standard,helios -resume --input="/Work/Groups/bisonex/data/giab/GRCh38/HG002_{1,2}.fq.gz --test.id=HG002
Only the capture file differs. Results are better using the capture file given by Agilent, stored in data/
    NXF_OPTS=-D"user.name=${USER}" nextflow run workflows/compareVCF.nf -profile standard,helios -resume --outdir=compareHG002 --test.id=HG002 --test.query=out/HG002_1/variantCalling/haplotypecaller/HG002_1.vcf.gz  --test.compare=vcfeval,happy --test.capture=data/AgilentSureSelectv05_hg38.bed
#
#+end_src
***** DONE Mauvais résultats
CLOSED: [2023-04-14 Fri 09:42]
avec vcfeval
Threshold  True-pos-baseline  True-pos-call  False-pos  False-neg  Precision  Sensitivity  F-measure
----------------------------------------------------------------------------------------------------
    0.000              24585          24390      10060      39415     0.7080       0.3841     0.4980
     None              24585          24390      10060      39415     0.7080       0.3841     0.4980
La sortie du variantCalling est celle d'happy ???
On relance...
***** DONE Vérifier vcf en hg38
CLOSED: [2023-04-12 Wed 10:33] SCHEDULED: <2023-04-12 Wed>
***** KILL Capture en hg19 ?
CLOSED: [2023-04-13 Thu 09:46] SCHEDULED: <2023-04-12 Wed>
***** KILL Vraiment fichier de capture ou zone d'intérêt ?
CLOSED: [2023-04-13 Thu 09:45] SCHEDULED: <2023-04-12 Wed>
"target region" +/- 50bp
[[https://ftp-trace.ncbi.nlm.nih.gov/ReferenceSamples/giab/data/AshkenazimTrio/analysis/OsloUniversityHospital_Exome_GATK_jointVC_11242015/README.txt][README]]
 list file describing the variant calling regions (target regions extended with 50 bp on each end)
***** DONE .bed fourni par AGilent: sensbilité très mauvaise
CLOSED: [2023-04-13 Thu 09:46] SCHEDULED: <2023-04-13 Thu>
Agilent SureSelect Human All Exon V5 kit
Disponible en hg38
Threshold  True-pos-baseline  True-pos-call  False-pos  False-neg  Precision  Sensitivity  F-measure
----------------------------------------------------------------------------------------------------
    0.000              19653          19501       6410      21657     0.7526       0.4757     0.5830
     None              19653          19501       6410      21657     0.7526       0.4757     0.5830
***** DONE Trier par nom avec samtools sort : bons résultats
CLOSED: [2023-04-14 Fri 09:25] SCHEDULED: <2023-04-13 Thu>
Avec capture fourni par GIAB
vcf eval
Threshold  True-pos-baseline  True-pos-call  False-pos  False-neg  Precision  Sensitivity  F-measure
----------------------------------------------------------------------------------------------------
    5.000              57443          57032        984       6557     0.9830       0.8975     0.9383
     None              57457          57046       1009       6543     0.9826       0.8978     0.9383
Happy
| Type  | Filter | TRUTH.TOTAL | TRUTH.TP | TRUTH.FN | QUERY.TOTAL | QUERY.FP | QUERY.UNK | FP.gt | FP.al | METRIC.Recall | METRIC.Precision | METRIC.Frac_NA | METRIC.F1_Score | TRUTH.TOTAL.TiTv_ratio | QUERY.TOTAL.TiTv_ratio | TRUTH.TOTAL.het_hom_ratio | QUERY.TOTAL.het_hom_ratio |
|-------+--------+-------------+----------+----------+-------------+----------+-----------+-------+-------+---------------+------------------+----------------+-----------------+------------------------+------------------------+---------------------------+---------------------------|
| INDEL | ALL    |        6150 |     5007 |     1143 |        6978 |      556 |      1346 |   151 |   168 |      0.814146 |         0.901278 |       0.192892 |          0.8555 |                        |                        |        1.5434221840068787 |        1.9467178175618074 |
| INDEL | PASS   |        6150 |     5007 |     1143 |        6978 |      556 |      1346 |   151 |   168 |      0.814146 |         0.901278 |       0.192892 |          0.8555 |                        |                        |        1.5434221840068787 |        1.9467178175618074 |
| SNP   | ALL    |       57818 |    52464 |     5354 |       56016 |      500 |      3046 |    90 |    30 |      0.907399 |         0.990561 |       0.054377 |        0.947158 |     2.4892012548262548 |      2.426824047458871 |        1.5904527117884357 |        1.6107795598657217 |
| SNP   | PASS   |       57818 |    52464 |     5354 |       56016 |      500 |      3046 |    90 |    30 |      0.907399 |         0.990561 |       0.054377 |        0.947158 |     2.4892012548262548 |      2.426824047458871 |        1.5904527117884357 |        1.6107795598657217 |
***** DONE Capture agilent légment meilleur que celui fourni par GIAB (padding ?)
CLOSED: [2023-04-14 Fri 09:48]
GIAB:
vcf eval
Threshold  True-pos-baseline  True-pos-call  False-pos  False-neg  Precision  Sensitivity  F-measure
----------------------------------------------------------------------------------------------------
    5.000              57443          57032        984       6557     0.9830       0.8975     0.9383
     None              57457          57046       1009       6543     0.9826       0.8978     0.9383
Happy
| Type  | Filter | TRUTH.TOTAL | TRUTH.TP | TRUTH.FN | QUERY.TOTAL | QUERY.FP | QUERY.UNK | FP.gt | FP.al | METRIC.Recall | METRIC.Precision | METRIC.Frac_NA | METRIC.F1_Score | TRUTH.TOTAL.TiTv_ratio | QUERY.TOTAL.TiTv_ratio | TRUTH.TOTAL.het_hom_ratio | QUERY.TOTAL.het_hom_ratio |
|-------+--------+-------------+----------+----------+-------------+----------+-----------+-------+-------+---------------+------------------+----------------+-----------------+------------------------+------------------------+---------------------------+---------------------------|
| INDEL | ALL    |        6150 |     5007 |     1143 |        6978 |      556 |      1346 |   151 |   168 |      0.814146 |         0.901278 |       0.192892 |          0.8555 |                        |                        |        1.5434221840068787 |        1.9467178175618074 |
| INDEL | PASS   |        6150 |     5007 |     1143 |        6978 |      556 |      1346 |   151 |   168 |      0.814146 |         0.901278 |       0.192892 |          0.8555 |                        |                        |        1.5434221840068787 |        1.9467178175618074 |
| SNP   | ALL    |       57818 |    52464 |     5354 |       56016 |      500 |      3046 |    90 |    30 |      0.907399 |         0.990561 |       0.054377 |        0.947158 |     2.4892012548262548 |      2.426824047458871 |        1.5904527117884357 |        1.6107795598657217 |
| SNP   | PASS   |       57818 |    52464 |     5354 |       56016 |      500 |      3046 |    90 |    30 |      0.907399 |         0.990561 |       0.054377 |        0.947158 |     2.4892012548262548 |      2.426824047458871 |        1.5904527117884357 |        1.6107795598657217 |
Agilent
Threshold  True-pos-baseline  True-pos-call  False-pos  False-neg  Precision  Sensitivity  F-measure
----------------------------------------------------------------------------------------------------
    6.000              37241          36965        449       4069     0.9880       0.9015     0.9428
     None              37248          36972        461       4062     0.9877       0.9017     0.9427
| Type  | Filter | TRUTH.TOTAL | TRUTH.TP | TRUTH.FN | QUERY.TOTAL | QUERY.FP | QUERY.UNK | FP.gt | FP.al | METRIC.Recall | METRIC.Precision | METRIC.Frac_NA | METRIC.F1_Score | TRUTH.TOTAL.TiTv_ratio | QUERY.TOTAL.TiTv_ratio | TRUTH.TOTAL.het_hom_ratio | QUERY.TOTAL.het_hom_ratio |
| INDEL | ALL    |        2909 |     2477 |      432 |        3229 |      207 |       519 |    52 |    50 |      0.851495 |         0.923616 |       0.160731 |        0.886091 |                        |                        |        1.4964850615114236 |        1.8339222614840989 |
| INDEL | PASS   |        2909 |     2477 |      432 |        3229 |      207 |       519 |    52 |    50 |      0.851495 |         0.923616 |       0.160731 |        0.886091 |                        |                        |        1.4964850615114236 |        1.8339222614840989 |
| SNP   | ALL    |       38406 |    34793 |     3613 |       36935 |      275 |      1868 |    37 |    15 |      0.905926 |         0.992158 |       0.050575 |        0.947083 |     2.6247759222568168 |     2.5752854654538417 |         1.588953331534934 |        1.6192536889897844 |
| SNP   | PASS   |       38406 |    34793 |     3613 |       36935 |      275 |      1868 |    37 |    15 |      0.905926 |         0.992158 |       0.050575 |        0.947083 |     2.6247759222568168 |     2.5752854654538417 |         1.588953331534934 |        1.6192536889897844 |
***** TODO Refaire : HiSeq4000 + agilent sureselect + génome "prêt à l'emploi"
SCHEDULED: <2023-06-25 Sun>
**** TODO HG003 :hg003:hg38:
***** Notes
#+begin_src sh
NXF_OPTS=-D"user.name=${USER}" nextflow run main.nf -profile standard,helios  --input /Work/Groups/bisonex/data/giab/GRCh38/HG003_{1,2}.fq.gz -bg
#+end_src
#+begin_src  sh
NXF_OPTS=-D"user.name=${USER}" nextflow run workflows/compareVCF.nf -profile standard,helios -resume --outdir=compareHG003  --test.id=HG003 --test.query=out/HG003_1/variantCalling/haplotypecaller/HG003_1.vcf.gz  --test.compare=vcfeval,happy --test.capture=data/AgilentSureSelectv05_hg38.bed
#+end_src
vcfeval
Threshold  True-pos-baseline  True-pos-call  False-pos  False-neg  Precision  Sensitivity  F-measure
----------------------------------------------------------------------------------------------------
    5.000              36745          36473        486       3988     0.9869       0.9021     0.9426
     None              36748          36476        495       3985     0.9866       0.9022     0.9425
$ zcat NA12878.snp_roc.tsv.gz  | tail -n 1 | awk '{print $7 $6}'
happy
Type Filter  TRUTH.TOTAL  TRUTH.TP  TRUTH.FN  QUERY.TOTAL  QUERY.FP  QUERY.UNK  FP.gt  FP.al  METRIC.Recall  METRIC.Precision  METRIC.Frac_NA  METRIC.F1_Score  TRUTH.TOTAL.TiTv_ratio  QUERY.TOTAL.TiTv_ratio  TRUTH.TOTAL.het_hom_ratio  QUERY.TOTAL.het_hom_ratio
INDEL    ALL         2731      2290       441         3092       208        577     62     53       0.838521          0.917296        0.186611         0.876141                     NaN                     NaN                   1.505145                   1.888993
INDEL   PASS         2731      2290       441         3092       208        577     62     53       0.838521          0.917296        0.186611         0.876141                     NaN                     NaN                   1.505145                   1.888993
  SNP    ALL        37997     34481      3516        36861       306       2074     33     13       0.907466          0.991204        0.056265         0.947488                2.611269                2.565915                   1.555780                   1.621727
  SNP   PASS        37997     34481      3516        36861       306       2074     33     13       0.907466          0.991204        0.056265         0.947488                2.611269                2.5659
***** TODO Refaire : HiSeq4000 + agilent sureselect + génome "prêt à l'emploi"
SCHEDULED: <2023-06-25 Sun>
**** TODO HG004 :hg38:
#+begin_src sh
NXF_OPTS=-D"user.name=${USER}" nextflow run main.nf -profile standard,helios  --input /Work/Groups/bisonex/data/giab/GRCh38/HG004_{1,2}.fq.gz -bg
#+end_src
vcfeval
Threshold  True-pos-baseline  True-pos-call  False-pos  False-neg  Precision  Sensitivity  F-measure
----------------------------------------------------------------------------------------------------
    6.000              36938          36678        421       4040     0.9887       0.9014     0.9430
     None              36942          36682        432       4036     0.9884       0.9015     0.9429
happy
 Type Filter  TRUTH.TOTAL  TRUTH.TP  TRUTH.FN  QUERY.TOTAL  QUERY.FP  QUERY.UNK  FP.gt  FP.al  METRIC.Recall  METRIC.Precision  METRIC.Frac_NA  METRIC.F1_Score  TRUTH.TOTAL.TiTv_ratio  QUERY.TOTAL.TiTv_ratio  TRUTH.TOTAL.het_hom_ratio  QUERY.TOTAL.het_hom_ratio
INDEL    ALL         2787      2388       399         3183       195        580     53     38       0.856835          0.925086        0.182218         0.889654                     NaN                     NaN                   1.507834                   1.848649
INDEL   PASS         2787      2388       399         3183       195        580     53     38       0.856835          0.925086        0.182218         0.889654                     NaN                     NaN                   1.507834                   1.848649
  SNP    ALL        38185     34560      3625        36921       254       2107     46      7       0.905067          0.992704        0.057068         0.946862                2.589175                2.553546                   1.632595                   1.653534
  SNP   PASS        38185     34560      3625        36921       254       2107     46      7       0.905067          0.992704        0.057068         0.946862                2.589175                2.553546                   1.632595                   1.653534
**** DONE Résumer résultats pour Paul + article :resultats:hg38:
CLOSED: [2023-04-06 Thu 21:41] SCHEDULED: <2023-04-02 Sun>
**** DONE Plot : ashkenazim trio :hg38:
CLOSED: [2023-04-18 Tue 21:27] SCHEDULED: <2023-04-16 Sun>
/Entered on/ [2023-04-16 Sun 17:29]
**** TODO Refaire : HiSeq4000 + agilent sureselect + génome "prêt à l'emploi"
SCHEDULED: <2023-06-25 Sun>
**** TODO NA12878 :na12878:T2T:
SCHEDULED: <2023-06-15 Thu>
*** KILL Platinum genome
CLOSED: [2023-06-14 Wed 22:37]
https://emea.illumina.com/platinumgenomes.html
*** TODO Séquencer NA12878
Discussion avec Paul : sous-traitant ne nous donnera pas les données, il faut commander l'ADN
** TODO Insilico :centogene:
*** TODO tous les variants centogène
**** DONE Extraire liste des SNVs
CLOSED: [2023-04-22 Sat 17:32] SCHEDULED: <2023-04-17 Mon>
***** DONE Corriger manquant à la main
CLOSED: [2023-04-22 Sat 17:31]
La sortie est sauvegardé dans git-annex : variants_success.csv
***** DONE Automatique
CLOSED: [2023-04-22 Sat 17:31]
**** DONE Convert SNVs : transcript -> génomique
CLOSED: [2023-06-03 Sat 17:16]
***** DONE Variant_recoder
CLOSED: [2023-04-26 Wed 21:21] SCHEDULED: <2023-04-22 Sat>
****** KILL Haskell: 160 manquant : recoded-success.csv
CLOSED: [2023-04-25 Tue 18:32]
La liste des variants a été générée en Haskel   l et nettoyée à la main.
On générer une liste de variant pour variant_rec            oder et on soumet tout d'un coup.
[[file:~/recherche/bisonex/parsevariants/app/Main.hs][parsevariant]]
#+begin_src haskell
recodeVariant = do
  prepareVariantRecod   er "variant_success.csv" "renamed.csv"
  runVariantRecoder "renamed.csv" "recoded.json"
#+end_src
#+RESULTS:
: <interactive>:4:3-19: error:
:     Variable not in scope: runVariantRecoder :: String -> String -> t
: gh
Problème : 160 n'ont pas pu être lu sur 820, probablement à cause du numéro mineur de transcrit
La sortie est sauvegardé dans git-annex : variants-recoded-raw.json.
****** KILL Julia
CLOSED: [2023-04-25 Tue 18:32]
On regénère la liste de variant et on passe à Julia pour préparer l'appel en parallèle à variant recoder
[[file:~/recherche/bisonex/parsevariants/variantRecoder.jl][variantRecoder.jl]]
#+begin_src julia
setupVariantRecoder(unique(init), n)
#+end_src
Puis
#+begin_src sh
parallel -a parallel-recoder.sh --jobs 10
#+end_src
On récupère les résultats
#+begin_src julia
(fails, success) = mergeVariantRecoder(n)
CSV.write(fSuccess, success)
CSV.write(fFailures, fails)
#+end_src
Certains variants ne sont pas trouvé, donc on prépare un nouveau job en enlevant les versionrs mineures des transcrits
#+begin_src julia
# Cleanup json and txt
if isfile(fSuccess) && isfile(fFailures)
    foreach(rm, variantRecoderInput())
    foreach(rm, variantRecoderOutput())
end
redoFails(fFailures)
#+end_src
Puis
#+begin_src sh
parallel -a parallel-recoder.sh --jobs 3
#+end_src
Il manque encore 70 transcrits
***** DONE Julia avec mobidetails: recode-failures-mobidetails.csv
CLOSED: [2023-04-25 Tue 18:58]
Nouvelle stratégie : on essaie une fois variant recoder.
Pour tous les échecs, on utilise mobidetails (~170).
Si l'ID n'est pas trouvé, on incrémente le numéro de version 2 fois
***** DONE Reste une dizaine à corriger à la main
CLOSED: [2023-04-26 Wed 21:21]
- [X] certains transcrits ont juste été supprimé
- [X] Erreur de parsing, manque souvent un -
#+begin_src julia
lastTryMobidetails("recoded-failures-mobidetails.csv")
#+end_src
***** DONE Fusionner données
CLOSED: [2023-04-26 Wed 22:35]
#+begin_src julia
function mergeAllGenomic()
    dNew = mergeAll("recoded-success.csv",
                    "recoded-failures-mobidetails.csv",
                    "recoded-failures-mobidetails-redo.csv")
    dInit = @chain DataFrame(CSV.File("variant_success.csv")) begin
        @transform :transcript = :transcript .* ":" .* :coding .* :codingPos .* :codingChange
        @select :file :transcript :classification :zygosity
        @rename :classificationCentogene = :classification
    end
    dTmp = outerjoin(dInit, dNew, on = :transcript)
    CSV.write("variant_genomic.csv", dTmp)
end
fSuccess = "recoded-success.csv"
fFailures = "recoded-failures.csv"
# variantRecoder(fSuccess, fFailures)
# mobidetailsOnFailures(fFailures)
# lastTryMobidetails("recoded-failures-mobidetails.csv")
mergeAllGenomic()
#+end_src
***** DONE Formatter donner pour simuscop
CLOSED: [2023-04-28 Fri 11:55] SCHEDULED: <2023-04-26 Wed>
**** TODO Extraire liste des CNVs
SCHEDULED: <2023-04-17 Mon>
**** TODO Simuscop :simuscop:
***** DONE Entrainer le modèle sur 63003856/
CLOSED: [2023-04-29 Sat 19:56]
Relancer le modèle pour être sûr
***** DONE Générer fastq avec simuscop (del et ins seulement) 20x
CLOSED: [2023-04-28 Fri 23:35] SCHEDULED: <2023-04-22 Sat>
****** DONE Génerer un profile avec bed de centogène
CLOSED: [2023-04-28 Fri 11:54] SCHEDULED: <2023-04-22 Sat>
NA12878 mais à refaire avec un vrai séquencage
Voir [[*Centogène][Bed Centogène]] pour choix
****** DONE Générer les données en 20x
CLOSED: [2023-04-28 Fri 11:54] SCHEDULED: <2023-04-22 Sat>
capture de centogene
****** DONE Regénérer en supprimant les doublons
CLOSED: [2023-04-28 Fri 17:28]
***** DONE Quelle couverture ?
CLOSED: [2023-04-29 Sat 18:26]
ex sur chr11:16,014,966 où on a 11 reads dans la simulation contre 200 !
****** 200 est la plus proche
#+attr_html: :width 500px
[[./simuscop-200-chr1-1.png]]
#+attr_html: :width 500px
[[./simuscop-200-chr1-2.png]]
****** DONE 20x
CLOSED: [2023-04-29 Sat 15:38]
****** DONE 50x
CLOSED: [2023-04-29 Sat 15:38]
****** DONE 100x
CLOSED: [2023-04-29 Sat 15:39]
****** DONE 200x
CLOSED: [2023-04-29 Sat 15:39]
***** DONE Reads mal centrés sur des petits exons seuls
CLOSED: [2023-04-29 Sat 19:56] SCHEDULED: <2023-04-29 Sat>
Capture ok : [[https://genome-euro.ucsc.edu/cgi-bin/hgTracks?db=hg38&lastVirtModeType=default&lastVirtModeExtraState=&virtModeType=default&virtMode=0&nonVirtPosition=&position=chr1%3A153817168%2D153817824&hgsid=296556270_F4fkENLPXHXidi2oALXls2jxNH9l][UCSC]] (track noire)
Mais mauvaise répartitiopn
#+attr_html: :width 800px
[[./simuscop-error.png]]
À tester
- Problème de profile ?
  - mauvais patient ?
  - mauvaise génération ? -> comparer avec ceux donnés sur github
- nom des chromosomes ?
****** DONE [#A] Tester sur exon 6 GATAD2B pour NC_000001.11:g.153817496A>T
CLOSED: [2023-04-29 Sat 19:56] SCHEDULED: <2023-04-29 Sat>
******* DONE Configuration + Profile 63003856.profile: idem, mal centré
CLOSED: [2023-04-29 Sat 19:18]
Téléchargement des données
#+begin_src sh :dir ~/code/bisonex/test-simuscop
scp meso:/Work/Projects/bisonex/data/genome/GRCh38.p14/genomeRef.fna .
scp meso:Work/Projects/bisonex/data/simuscop/*.profile .
scp -r meso:/Work/Projects/bisonex/data/genome/GRCh38.p13/bwa .
#+end_src
On récupère l'exon (NB: org-mode ne lance pas le code...)
#+begin_src julia
using CSV,DataFramesMeta
d = CSV.read("VCGS_Exome_Covered_Targets_hg38_40.1MB_renamed.bed", header=false, delim="\t", DataFrame)
@subset d :Column1 .== "NC_000001.11" :Column2 .<= 153817496 :Column3 .>= 153817496
#+end_src
NC_000001.11  153817371  153817542
Génération du bed
#+begin_src sh :dir ~/code/bisonex/test-simuscop
echo -e "NC_000001.11\t153817371\t153817542" > gatad2b-exon6.bed
#+end_src
#+RESULTS:
Génération d'un variant
#+begin_src sh :dir ~/code/bisonex/test-simuscop
echo -e "s\tsingle\tNC_000001.11\t153817496\tA\tT\thet"> variant.txt
#+end_src
#+RESULT

Replacement in projects/bisonex.org at line 50 [4.35]

B:BD[7.58027] → [7.58027:58765]

TGGGTGCTGTGGTCTCAGTGCCACCGATCAGGAGGTCCACTGCAGCCATGTGCAAGTGCCCTTCCAGGAGCTGTCCAGAGCCCTCT
+
FFFFFFFFFFFFFFFFFFFFFFF:FFF:FFFFFFFFFFFFF,FFFFFFFFFFFF:F:FFFF:FFFFF,,FFF:FFFFFFFFFF,FFFFFFF,FFFFFFFFFFF,FFFFFFFFF:FFFF,F:FFFFF:FFFFFFFFF:FFFF,FFFFFFFFF
******* DONE Supprimer NW_ et NT_
***** TODO Phase 2 : chr22, vaf variable :T2T:
SCHEDULED: <2023-06-29 Thu>
****** TODO Phase 3 : tous SNV, vaf variable :T2T:
SCHEDULED: <2023-06-29 Thu>
***** TODO Test Indel
**** Divers
***** DONE Vérifier nombre de reads fastq - bam
CLOSED: [2022-10-09 Sun 22:31]
*** KILL Liste varants "clinically relevent" (Clinge - CT-R d)
CLOSED: [2023-06-25 Sun 15:53] SCHEDULED: <2023-06-25 Sun>
[cite:@wilcox2021]
Vu avec alexis: pas notre cas d'usage

[7.58027]

TGGGTGCTGTGGTCTCAGTGCCACCGATCAGGAGGTCCACTGCAGCCATGTGCAAGTGCCCTTCCAGGAGCTGTCCAGAGCCCTCT
+
FFFFFFFFFFFFFFFFFFFFFFF:FFF:FFFFFFFFFFFFF,FFFFFFFFFFFF:F:FFFF:FFFFF,,FFF:FFFFFFFFFF,FFFFFFF,FFFFFFFFFFF,FFFFFFFFF:FFFF,F:FFFFF:FFFFFFFFF:FFFF,FFFFFFFFF
******* DONE Supprimer NW_ et NT_
***** TODO Phase 2 : chr22, vaf variable :T2T:
SCHEDULED: <2023-07-01 Sat>
****** TODO Phase 3 : tous SNV, vaf variable :T2T:
SCHEDULED: <2023-07-01 Sat>
***** TODO Test Indel
**** Divers
***** DONE Vérifier nombre de reads fastq - bam
CLOSED: [2022-10-09 Sun 22:31]
*** KILL Liste varants "clinically relevent" (Clinge - CT-R d)
CLOSED: [2023-06-25 Sun 15:53] SCHEDULED: <2023-06-25 Sun>
[cite:@wilcox2021]
Vu avec alexis: pas notre cas d'usage

Replacement in notes/medecine/20230528225531-bacteries.org at line 95 [8.10483]
B:BD[8.14747] → [8.14747:14748]
[8.14747]
[8.14748]
```
Infections graves = /pyogenes/, /pneumoniae/.
Commensal mais opportunites (immunodépression) : oraux (*endocardite, SDRA)
```

Replacement in notes/medecine/20230528225531-bacteries.org at line 98 [8.10483]

B:BD[8.14767] → [8.14767:15006]

- α-hémolytique : hémolyse partielle
  - viridans
  - Pneumocoque: résistance par chimérisme PLP (acquis)
- β-hémolyse : hémolyse totale
  - Groupe A = S. pyogenes surtout. Cause d’angine++. *Pas de résistance aux β-lactamine*

[8.14767]

[8.15006]

- Hémolyse : α  partielle, β = totale.
- Lancefield : classification selon les polysaccharide de la paroi bactérienne (agglutination).
En première approximation :
- α-hémolyse = non-groupable
  - /pneumoniae/ résistance par chimérisme PLP (acquis)
  - autres anginosus, mitis, sanguinis, bovis, salivarius, mutans
- β-hémolyse = groupable. Les plus importants
  - Groupe A = S. pyogenes. Cause d’angine++. *Pas de résistance aux β-lactamine*

Replacement in notes/medecine/20230528225531-bacteries.org at line 109 [8.10483]

B:BD[8.15175] → [8.15175:15232]

  - Groupe autres: D->H, K-T(Lancefield)
- Non groupable

[8.15175]

[8.15232]

  - C : /dysagalactia/ (rarement /equi/)
  - G : /dysgalactia/, /canis/
/Note/: certaines sous-espèce de Lancefield peuvente être alpha-hémolytique

Insertion in notes/medecine/20230528225531-bacteries.org at line 116 [8.10483]

[8.15379]

*** Classification d’Ambler
A. BLSE
   - résistance pénicilline, C1, C2, C3G
   - sensible inhibiteur β-lactamase et carbapénème
   - détecté par ceftazidime + acide clavulanique
B. Métallo-beta-lactamases
   - résistance comme B. + carbapénème
C. ampC céphalosporinase
   - résistance BLSE + céfoxitine + inhibiteur β-lactamase
   - sensible carbapneme
   - détecté céfoxitine
D. oxacillinase
   - sensible β-lactamase