apraga/org - Change NOSKNBT5E7NBZWFZGVJXIUTYJGSS4RIAKKSATBDKBQGN4LSQ2KJAC

Bisonex update

Created by Alexis Praga on July 9, 2023

NOSKNBT5E7NBZWFZGVJXIUTYJGSS4RIAKKSATBDKBQGN4LSQ2KJAC

Dependencies

In channels

main

Change contents

Replacement in projects/bisonex.org at line 4 [4.35]

B:BD[3.8199] → [3.8199:8221]

B:BD[3.8221] → [5.29:6716]

∅:D[5.6716] → [6.8221:9704]

B:BD[6.8221] → [6.8221:9704]

monSNP non patho
CLOS
ED: [2023-06-14 Wed 22:35]
***** DONE compatibilité hg38
CLOSED: [2023-06-14 Wed 22:35]
**** TODO cache vep
SCHEDULED: <2023-07-10 Mon>
*** HOLD Processing bases de données
**** DONE dbSNP common
**** DONE Seulement les ID dans dbSNP common !
CLOSED: [2022-11-19 Sat 21:42]
172G au lieu de 253M...
**** HOLD common dbSNP not clinvar patho
***** DONE Conclusion partielle
CLOSED: [2022-12-12 Mon 22:25]
- vcfeval : prometteur mais n'arrive pas à traiter toutes les régions
- isec : trop de problèmes avec
- classif clinvar directement dans dbSNP: le plus simple
  Et ça permet de rattraper quelques erreurs dans le script d'Alexis
***** KILL Utiliser directement le numéro dbSNP dans clinvar ? Non
CLOSED: [2022-11-20 Sun 19:51]
Ex: chr20
#+begin_src sh :dir ~/code/bisonex/test_isec
bcftools query -f 'rs%INFO/RS \n' -i 'INFO/RS != "." & INFO/CLNSIG="Pathogenic"' clinvar_chr20.vcf.gz | sort > ID_clinvar_patho.txt
bcftools query -f '%ID\n' dbSNP_common_chr20.vcf.gz | sort > ID_of_common_snp.txt
comm -23 ID_of_common_snp.txt ID_clinvar_patho.txt > ID_of_common_snp_not_clinvar_patho.txt
wc -l ID_of_common_snp_not_clinvar_patho.txt
# sort ID
#+end_src
#+RESULTS:
: 518846 ID_of_common_snp_not_clinvar_patho.txt
Version d'alexis
#+begin_src sh :dir ~/code/bisonex/test_isec
snp=dbSNP_common_chr20.vcf.gz
clinvar=clinvar_chr20_notremapped.vcf.gz
python ../script/pythonScript/clinvar_sbSNP.py \
    --clinvar $clinvar \
    --chrm_name_table ../database/RefSeq/refseq_to_number_only_consensual.txt \
    --dbSNP $snp --output prod.txt
wc -l prod.txt
zgrep '^NC' dbSNP_common_chr20.vcf.gz | wc -l
#+end_src
#+RESULTS:
| 518832 | prod.txt |
| 518846 |          |
***** KILL classification clinvar codée dbSNP ?
CLOSED: [2022-12-04 Sun 14:38]
Sur le chromosome 20
*Attention* CLNSIG a plusieurs champs (séparé par une virgule)
On y accède avec INFO/CLNSIG[*]
Ensuite, chaque item peut avoir plusieurs haploïdie (séparé par un |). IL faut donc utiliser une regexp
NB: *ne pas mettre la condition* dans une variable !!
Pour avoir les clinvar patho, on veut 5 mais pas 255 (= autre) pour la classification !`
Il faut également les likely patho et conflicting
#+begin_src sh :dir ~/code/bisonex/test_isec
bcftools query -f '%INFO/CLNSIG\n' dbSNP_common_chr20.vcf.gz -i \
'INFO/CLNSIG[*]~"^5|" | INFO/CLNSIG[*]=="5" | INFO/CLNSIG[*]~"|5" | INFO/CLNSIG[*]~"^4|" | INFO/CLNSIG[*]=="4" | INFO/CLNSIG[*]~"|4" | INFO/CLNSIG[*]~"^12|" | INFO/CLNSIG[*]=="12" | INFO/CLNSIG[*]~"|12"' | sort
#+end_src
#+RESULTS:
| . |  . | 12 |    |   |   |   |   |   |   |   |
| . | 12 |  0 |  2 |   |   |   |   |   |   |   |
| 2 |  3 |  2 |  2 | 2 | 5 | . |   |   |   |   |
| . |  2 |  3 |  2 | 2 | 4 |   |   |   |   |   |
| . |  . |  3 | 12 | 3 |   |   |   |   |   |   |
| . |  5 |  2 |  . |   |   |   |   |   |   |   |
| . |  . |  . |  5 | 2 | 2 |   |   |   |   |   |
| . |  9 |  9 |  9 | 5 | 5 | 2 | 3 | 2 | 3 | 2 |
Si on les exclut :
#+begin_src sh :dir ~/code/bisonex/test_isec
bcftools query -f '%ID\n' dbSNP_common_chr20.vcf.gz -e \
'INFO/CLNSIG[*]~"^5|" | INFO/CLNSIG[*]=="5" | INFO/CLNSIG[*]~"|5" | INFO/CLNSIG[*]~"4" | INFO/CLNSIG[*]~"12"' | sort | uniq > common-notpatho.txt
#+end_src
#+RESULTS:
 #+begin_src sh :dir ~/code/bisonex/test_isec
snp=dbSNP_common_chr20.vcf.gz
clinvar=clinvar_chr20_notremapped.vcf.gz
python ../script/pythonScript/clinvar_sbSNP.py \
    --clinvar $clinvar \
    --chrm_name_table ../database/RefSeq/refseq_to_number_only_consensual.txt \
    --dbSNP $snp --output tmp.txt
sort tmp.txt | uniq > common-notpatho-alexis.txt
wc -l common-notpatho-alexis.txt
 #+end_src
 #+RESULTS:
 : 518832 common-notpatho-alexis.txt
On en a 6 de plus que la version d'Alexis mais quelques différences
Ceux d'Alexis qui manquent:
#+begin_src sh :dir ~/code/bisonex/test_isec
comm -23 common-notpatho-alexis.txt common-notpatho.txt > alexis-only.txt
cat alexis-only.txt
#+end_src
#+RESULTS:
| rs1064039  |
| rs3833341  |
| rs73598374 |
On les teste dans clinvar et dbSNP
#+begin_src sh :dir ~/code/bisonex/test_isec
bcftools query -f '%POS %REF %ALT %INFO/CLNSIG\n' -i 'ID=@alexis-only.txt' dbSNP_common_chr20.vcf.gz
bcftools query -f '%POS\n' -i 'ID=@alexis-only.txt' dbSNP_common_chr20.vcf.gz > alexis-only-pos.txt
while read  -r line; do
bcftools query -f '%POS %REF %ALT %INFO/CLNSIG\n' -i 'POS='$line clinvar_chr20.vcf.gz
done < alexis-only-pos.txt
# bcftools query -f '%POS %REF %ALT %INFO/CLNSIG\n' -i 'POS=23637790' clinvar_chr20.vcf.gz
#+end_src
#+RESULTS:
|   764018 | A | ACAGGTCAAT,ACAGGT | .,5     | 2,. |   |
| 23637790 | C | G,T               | .,.,12  |     |   |
| 44651586 | C | A,G,T             | .,.,.,5 |   2 | 2 |
|   764018 | A | ACAGGTCAAT        | Benign  |     |   |
| 23637790 | C | T                 | Benign  |     |   |
| 44651586 | C | T                 | Benign  |     |   |
On a donc une discordance entre clinvar et dbSNP.
On dirait qu'ils ont mal fait l'intersection avec clinvar.
Par exemple https://www.ncbi.nlm.nih.gov/snp/rs3833341#clinical_significance
Tu as l'impression qu'il y a un 1 clinvar bénin et 1 patho.
En cherchant par NM, tu vois qu'il est bénin sur clinvar car il y a d'autres soumissions ! https://www.ncbi.nlm.nih.gov/clinvar/variation/262235/
Confirmation sur nos bases de données :
$ bcftools query -f '%POS %REF %ALT %INFO/CLNSIG\n' -i 'POS=764018' dbSNP_common_chr20.vcf.gz
764018 A ACAGGTCAAT,ACAGGT .,5|2,.
$ bcftools query -f '%POS %REF %ALT %INFO/CLNSIG\n' -i 'POS=764018' clinvar_chr20.vcf.gz
764018 A ACAGGTCAAT Benign
***** KILL Corriger script alexi
CLOSED: [2022-12-04 Sun 13:03]
Gère clinvar patho, probablement patho ou conflicting !
***** HOLD Rtg tools
****** Test
1. Générer SDf file
   #+begin_src sh
rtg format genomeRef.fna  -o genomeRef.sdf
   #+end_src
2. Pour les bases de donnés, il faut l'option --sample ALT sinon on a
 #+begin_src
$ rtg vcfeval -b dbSNP_common.vcf.gz -c clinvar.vcf.gz -o test -t genomeRef.sdf/^C
VCF header does not contain a FORMAT field named GQ
Error: Record did not contain enough samples: NC_000001.11	10001	rs1570391677	A,C	.	PASS	RS=1570391677;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;R5;GNO;FREQ=KOREAN:0.9891,0.0109,.|SGDP_PRJ:0,1,.|dbGaP_PopFreq:1,.,0;COMMON
 #+end_src
 Essai intersection clinvar (patho ou non) dbSNP
   - faux négatif = dbSNP common qui ne sont pas dans clinvar
   - faux positif = clinvar qui ne sont pas dbSNP common
   - vrai positif = clinvar qui sont dans dbSNP common
   - vrai positif baseline = dbSNP common qui sont dans cl
invar
 On calcule le nombre de lignes
 #+begin_src ssh
zgrep '^[^#]' /Work/Groups/bisonex/data/clinvar/GRCh38/clinvar.vcf.gz | wc -l
for i in *.vcf.gz; do echo $i; zgrep '^[^#]' $i | wc -l; done
 #+end_src
 | clinvar            |  1493470 |
 | fn.vcf.gz          | 22330220 |
 | fp.vcf.gz          |  1222529 |
 | tp-baseline.vcf.gz |   131040 |
 | tp.vcf.gz          |   136638 |
À noter qu'on ne retrouve pas tout clinvar...
1222529 + 131040 = 1353569 < 1493470
certains régions ne sont pas traitées :
#+begin_quote
Evaluation too complex (50002 unresolved paths, 34891 iterations) at reference region NC_000001.11:790930-790970. Variants in this region will not be included in results
#+end_quote
#+begin_src sh
grep 'not be included' vcfeval.log | wc -l
56192
#+end_src
Le total est quand même inférieur
On veut les clinvar non patho dans dbSNP soit les faux négatif (dbSNP common not contenu dans clinvar patho)
#+begin_src sh
bcftools filter -i 'INFO/CLNSIG="Pathogenic"' /Work/Groups/bisonex/data/clinvar/GRCh38/clinvar.vcf.gz -o /Work/Groups/bisonex/data/clinvar/GRCh38/clinvar-patho.vcf.gz
tabix /Work/Groups/bisonex/data/clinvar/GRCh38/clinvar-patho.vcf.gz
#+end_src
On lance le script (dbSNP common et clinvar = 9h)
#+begin_src sh
#!/bin/bash
#SBATCH --nodes=1
#SBATCH -p smp
#SBATCH --time=12:00:00
#SBATCH --mem=12G
dir=/Work/Groups/bisonex/data
dbSNP=$dir/dbSNP/GRCh38.p13/dbSNP_common.vcf.gz
clinvar=$dir/clinvar/GRCh38/cl

[3.8199]

[6.9704]

monSNP non patho
CLOSED: [2023-06-14 Wed 22:35]
***** DONE compatibilité hg38
CLOSED: [2023-06-14 Wed 22:35]
**** TODO cache vep
SCHEDULED: <2023-07-16 Sun>
*** HOLD Processing bases de données
**** DONE dbSNP common
**** DONE Seulement les ID dans dbSNP common !
CLOSED: [2022-11-19 Sat 21:42]
172G au lieu de 253M...
**** HOLD common dbSNP not clinvar patho
***** DONE Conclusion partielle
CLOSED: [2022-12-12 Mon 22:25]
- vcfeval : prometteur mais n'arrive pas à traiter toutes les régions
- isec : trop de problèmes avec
- classif clinvar directement dans dbSNP: le plus simple
  Et ça permet de rattraper quelques erreurs dans le script d'Alexis
***** KILL Utiliser directement le numéro dbSNP dans clinvar ? Non
CLOSED: [2022-11-20 Sun 19:51]
Ex: chr20
#+begin_src sh :dir ~/code/bisonex/test_isec
bcftools query -f 'rs%INFO/RS \n' -i 'INFO/RS != "." & INFO/CLNSIG="Pathogenic"' clinvar_chr20.vcf.gz | sort > ID_clinvar_patho.txt
bcftools query -f '%ID\n' dbSNP_common_chr20.vcf.gz | sort > ID_of_common_snp.txt
comm -23 ID_of_common_snp.txt ID_clinvar_patho.txt > ID_of_common_snp_not_clinvar_patho.txt
wc -l ID_of_common_snp_not_clinvar_patho.txt
# sort ID
#+end_src
#+RESULTS:
: 518846 ID_of_common_snp_not_clinvar_patho.txt
Version d'alexis
#+begin_src sh :dir ~/code/bisonex/test_isec
snp=dbSNP_common_chr20.vcf.gz
clinvar=clinvar_chr20_notremapped.vcf.gz
python ../script/pythonScript/clinvar_sbSNP.py \
    --clinvar $clinvar \
    --chrm_name_table ../database/RefSeq/refseq_to_number_only_consensual.txt \
    --dbSNP $snp --output prod.txt
wc -l prod.txt
zgrep '^NC' dbSNP_common_chr20.vcf.gz | wc -l
#+end_src
#+RESULTS:
| 518832 | prod.txt |
| 518846 |          |
***** KILL classification clinvar codée dbSNP ?
CLOSED: [2022-12-04 Sun 14:38]
Sur le chromosome 20
*Attention* CLNSIG a plusieurs champs (séparé par une virgule)
On y accède avec INFO/CLNSIG[*]
Ensuite, chaque item peut avoir plusieurs haploïdie (séparé par un |). IL faut donc utiliser une regexp
NB: *ne pas mettre la condition* dans une variable !!
Pour avoir les clinvar patho, on veut 5 mais pas 255 (= autre) pour la classification !`
Il faut également les likely patho et conflicting
#+begin_src sh :dir ~/code/bisonex/test_isec
bcftools query -f '%INFO/CLNSIG\n' dbSNP_common_chr20.vcf.gz -i \
'INFO/CLNSIG[*]~"^5|" | INFO/CLNSIG[*]=="5" | INFO/CLNSIG[*]~"|5" | INFO/CLNSIG[*]~"^4|" | INFO/CLNSIG[*]=="4" | INFO/CLNSIG[*]~"|4" | INFO/CLNSIG[*]~"^12|" | INFO/CLNSIG[*]=="12" | INFO/CLNSIG[*]~"|12"' | sort
#+end_src
#+RESULTS:
| . |  . | 12 |    |   |   |   |   |   |   |   |
| . | 12 |  0 |  2 |   |   |   |   |   |   |   |
| 2 |  3 |  2 |  2 | 2 | 5 | . |   |   |   |   |
| . |  2 |  3 |  2 | 2 | 4 |   |   |   |   |   |
| . |  . |  3 | 12 | 3 |   |   |   |   |   |   |
| . |  5 |  2 |  . |   |   |   |   |   |   |   |
| . |  . |  . |  5 | 2 | 2 |   |   |   |   |   |
| . |  9 |  9 |  9 | 5 | 5 | 2 | 3 | 2 | 3 | 2 |
Si on les exclut :
#+begin_src sh :dir ~/code/bisonex/test_isec
bcftools query -f '%ID\n' dbSNP_common_chr20.vcf.gz -e \
'INFO/CLNSIG[*]~"^5|" | INFO/CLNSIG[*]=="5" | INFO/CLNSIG[*]~"|5" | INFO/CLNSIG[*]~"4" | INFO/CLNSIG[*]~"12"' | sort | uniq > common-notpatho.txt
#+end_src
#+RESULTS:
 #+begin_src sh :dir ~/code/bisonex/test_isec
snp=dbSNP_common_chr20.vcf.gz
clinvar=clinvar_chr20_notremapped.vcf.gz
python ../script/pythonScript/clinvar_sbSNP.py \
    --clinvar $clinvar \
    --chrm_name_table ../database/RefSeq/refseq_to_number_only_consensual.txt \
    --dbSNP $snp --output tmp.txt
sort tmp.txt | uniq > common-notpatho-alexis.txt
wc -l common-notpatho-alexis.txt
 #+end_src
 #+RESULTS:
 : 518832 common-notpatho-alexis.txt
On en a 6 de plus que la version d'Alexis mais quelques différences
Ceux d'Alexis qui manquent:
#+begin_src sh :dir ~/code/bisonex/test_isec
comm -23 common-notpatho-alexis.txt common-notpatho.txt > alexis-only.txt
cat alexis-only.txt
#+end_src
#+RESULTS:
| rs1064039  |
| rs3833341  |
| rs73598374 |
On les teste dans clinvar et dbSNP
#+begin_src sh :dir ~/code/bisonex/test_isec
bcftools query -f '%POS %REF %ALT %INFO/CLNSIG\n' -i 'ID=@alexis-only.txt' dbSNP_common_chr20.vcf.gz
bcftools query -f '%POS\n' -i 'ID=@alexis-only.txt' dbSNP_common_chr20.vcf.gz > alexis-only-pos.txt
while read  -r line; do
bcftools query -f '%POS %REF %ALT %INFO/CLNSIG\n' -i 'POS='$line clinvar_chr20.vcf.gz
done < alexis-only-pos.txt
# bcftools query -f '%POS %REF %ALT %INFO/CLNSIG\n' -i 'POS=23637790' clinvar_chr20.vcf.gz
#+end_src
#+RESULTS:
|   764018 | A | ACAGGTCAAT,ACAGGT | .,5     | 2,. |   |
| 23637790 | C | G,T               | .,.,12  |     |   |
| 44651586 | C | A,G,T             | .,.,.,5 |   2 | 2 |
|   764018 | A | ACAGGTCAAT        | Benign  |     |   |
| 23637790 | C | T                 | Benign  |     |   |
| 44651586 | C | T                 | Benign  |     |   |
On a donc une discordance entre clinvar et dbSNP.
On dirait qu'ils ont mal fait l'intersection avec clinvar.
Par exemple https://www.ncbi.nlm.nih.gov/snp/rs3833341#clinical_significance
Tu as l'impression qu'il y a un 1 clinvar bénin et 1 patho.
En cherchant par NM, tu vois qu'il est bénin sur clinvar car il y a d'autres soumissions ! https://www.ncbi.nlm.nih.gov/clinvar/variation/262235/
Confirmation sur nos bases de données :
$ bcftools query -f '%POS %REF %ALT %INFO/CLNSIG\n' -i 'POS=764018' dbSNP_common_chr20.vcf.gz
764018 A ACAGGTCAAT,ACAGGT .,5|2,.
$ bcftools query -f '%POS %REF %ALT %INFO/CLNSIG\n' -i 'POS=764018' clinvar_chr20.vcf.gz
764018 A ACAGGTCAAT Benign
***** KILL Corriger script alexi
CLOSED: [2022-12-04 Sun 13:03]
Gère clinvar patho, probablement patho ou conflicting !
***** HOLD Rtg tools
****** Test
1. Générer SDf file
   #+begin_src sh
rtg format genomeRef.fna  -o genomeRef.sdf
   #+end_src
2. Pour les bases de donnés, il faut l'option --sample ALT sinon on a
 #+begin_src
$ rtg vcfeval -b dbSNP_common.vcf.gz -c clinvar.vcf.gz -o test -t genomeRef.sdf/^C
VCF header does not contain a FORMAT field named GQ
Error: Record did not contain enough samples: NC_000001.11	10001	rs1570391677	A,C	.	PASS	RS=1570391677;dbSNPBuildID=154;SSR=0;PSEUDOGENEINFO=DDX11L1:100287102;VC=SNV;R5;GNO;FREQ=KOREAN:0.9891,0.0109,.|SGDP_PRJ:0,1,.|dbGaP_PopFreq:1,.,0;COMMON
 #+end_src
 Essai intersection clinvar (patho ou non) dbSNP
   - faux négatif = dbSNP common qui ne sont pas dans clinvar
   - faux positif = clinvar qui ne sont pas dbSNP common
   - vrai positif = clinvar qui sont dans dbSNP common
   - vrai positif baseline = dbSNP common qui sont dans clinvar
 On calcule le nombre de lignes
 #+begin_src ssh
zgrep '^[^#]' /Work/Groups/bisonex/data/clinvar/GRCh38/clinvar.vcf.gz | wc -l
for i in *.vcf.gz; do echo $i; zgrep '^[^#]' $i | wc -l; done
 #+end_src
 | clinvar            |  1493470 |
 | fn.vcf.gz          | 22330220 |
 | fp.vcf.gz          |  1222529 |
 | tp-baseline.vcf.gz |   131040 |
 | tp.vcf.gz          |   136638 |
À noter qu'on ne retrouve pas tout clinvar...
1222529 + 131040 = 1353569 < 1493470
certains régions ne sont pas traitées :
#+begin_quote
Evaluation too complex (50002 unresolved paths, 34891 iterations) at reference region NC_000001.11:790930-790970. Variants in this region will not be included in results
#+end_quote
#+begin_src sh
grep 'not be included' vcfeval.log | wc -l
56192
#+end_src
Le total est quand même inférieur
On veut les clinvar non patho dans dbSNP soit les faux négatif (dbSNP common not contenu dans clinvar patho)
#+begin_src sh
bcftools filter -i 'INFO/CLNSIG="Pathogenic"' /Work/Groups/bisonex/data/clinvar/GRCh38/clinvar.vcf.gz -o /Work/Groups/bisonex/data/clinvar/GRCh38/clinvar-patho.vcf.gz
tabix /Work/Groups/bisonex/data/clinvar/GRCh38/clinvar-patho.vcf.gz
#+end_src
On lance le script (dbSNP common et clinvar = 9h)
#+begin_src sh
#!/bin/bash
#SBATCH --nodes=1
#SBATCH -p smp
#SBATCH --time=12:00:00
#SBATCH --mem=12G
dir=/Work/Groups/bisonex/data
dbSNP=$dir/dbSNP/GRCh38.p13/dbSNP_common.vcf.gz
clinvar=$dir/clinvar/GRCh38/cl

Replacement in projects/bisonex.org at line 8 [4.35]

B:BD[5.8200] → [5.8200:8222]

B:BD[5.8222] → [7.41747:49917]

on=2.7
conda activate
 py2
conda install -c bioconda hap.py
#+end_src
******** Faire tourner les tests.
Il faut remplace bin/test_haplotypes par test_haplotypes dans src/sh/run_tests.sh
#+begin_src sh
 HGREF=../genome/GRCh38/GCA_000001405.15_GRCh38_no_alt_analysis_set.fasta HCDIR=~/anaconda3/envs/py2/bin bash src/sh/run_tests.sh
#+end_src
Echec:
test_haplotypes: /opt/conda/conda-bld/work/hap.py-0.3.7/src/c++/lib/tools/Fasta.cpp:81: MMappedFastaFile::MMappedFastaFile(const string&): Assertion `fd != -1' failed.
unknown location(0): fatal error in "testVariantPrimitiveSplitter": signal: SIGABRT (application abort requested)
/opt/conda/conda-bld/work/hap.py-0.3.7/src/c++/test/test_align.cpp(298): last checkpoint
******** Chr21
HGREF=../genome/GRCh38/GCA_000001405.15_GRCh38_no_alt_analysis_set.fasta hap.py        example/happy/PG_NA12878_chr21.vcf.gz       example/happy/NA12878_chr21.vcf.gz       -f example/happy/PG_Conf_chr21.bed.gz       -o test
******* Helios
échec
** TODO T2T :T2T:
Toutes les ressourcs sont décrites ici
https://github.com/marbl/CHM13
Détails sur le pipeline
https://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hub_3267197_GCA_009914755.4&c=CP068277.2&g=hub_3267197_hgLiftOver
*** DONE Alignement
CLOSED: [2023-06-26 Mon 19:42]
NXF_OPTS=-D"user.name=${USER}" nextflow run main.nf -profile standard,helios  --input="/Work/Groups/bisonex/data/giab/*_R{1,2}_001.fastq.gz" --id=NA12878-T2T -bg
SCHEDULED: <2023-06-14 Wed>
*** DONE Haplotypecaller
CLOSED: [2023-06-26 Mon 19:42] SCHEDULED: <2023-06-15 Thu>
*** TODO Filtres
SCHEDULED: <2023-07-10 Mon>
*** Liftover pipelines
:PROPERTIES:
:ID:       d2280207-3f65-4a31-a291-41fa9a9658c2
:END:
Contient les chain files
** TODO Indicateurs qualité
SCHEDULED: <2023-07-14 Fri>
*** Idée
Raredisease:
- FastQC : nombreuses statistiques. Non disponible Nix
- Mosdepth : calcule la profondeur (2x plus rapide que samtools depth). Nix
- MultiQC : fusionne juste les résultats des analyses. Non disponible nix
- Picard's CollectMutipleMetrics, CollectHsMetrics, and CollectWgsMetrics
- Qualimap : alternative fastqc ? Non disponible nix
- Sentieon's WgsMetricsAlgo : propriétaire
- TIDDIT's cov : TIDIT = remaninement chromosomique
Sarek:
- alignment statistics : samtools stats, mosdepth
- QC : MultiQC
MultiQC : non disponible Nix
** TODO vérifier si normalisation
SCHEDULED: <2023-07-14 Fri>
** TODO Rajouter vérification hgvs
SCHEDULED: <2023-07-14 Fri>
** DONE Exécution
CLOSED: [2022-09-13 Tue 21:37]
*** KILL test Bionix
*** KILL Implémenter execution avec Nix ?
Voir https://academic.oup.com/gigascience/article/9/11/giaa121/5987272?login=false
pour un exemple.
Probablement plus simple d’utiliser Nix pour gestion de l’environnement et snakemake pour l’exécution
Pas d’accès internet depuis le cluster
*** DONE nextflow
CLOSED: [2022-09-13 Tue 21:37]
**** TODO Bug scheduler SGE
Le job se fait tuer car l'utilisateur n'est pas passé correctement à nextflow
***** DONE Forcer l'utilisateur à l'exécution
CLOSED: [2023-04-01 Sat 17:57]
NXF_OPTS=-D"user.name=alex"
***** DONE Vérifier si le problème persiste avec 22.10.6
CLOSED: [2023-04-01 Sat 18:38] SCHEDULED: <2023-04-01 Sat>
oui
***** KILL Packager l'utilisateur dans le programme ?
Mauvaise idée..
** TODO Preprocessing avec nextflow
*** TODO Map to reference
**** TODO Sample ID dans header
/Work/Users/apraga/bisonex/out/63003856_S135/preprocessing/baserecalibrator
*** DONE Mark duplicate
CLOSED: [2022-10-09 Sun 22:30]
*** DONE Recalibrate base quality score
CLOSED: [2022-10-09 Sun 22:30]
** DONE Variant calling avec Nextflow
CLOSED: [2022-11-19 Sat 21:34]
*** DONE Haplotype caller
CLOSED: [2022-10-09 Sun 22:40]
*** DONE Filter variants
CLOSED: [2022-10-09 Sun 22:40]
*** DONE Filter common snp not clinvar path
CLOSED: [2022-11-07 Mon 23:00]
Voir [[*common dbSNP not clinvar patho][common dbSNP not clinvar patho]]
*** DONE Filter variant only in consensual sequence
CLOSED: [2022-11-08 Tue 22:23]
*** DONE Filter technical variants
CLOSED: [2022-11-19 Sat 21:34]
*** DONE Utilise AVX pour accélerer l'exécution
CLOSED: [2023-04-29 Sat 15:46]
Sans cela, on a l'avertissement
#+begin_quote
17:28:00.720 INFO  PairHMM - OpenMP multi-threaded AVX-accelerated native PairHMM implementation is not supported
17:28:00.721 INFO  NativeLibraryLoader - Loading libgkl_utils.so from jar:file:/nix/store/cy9ckxqwrkifx7wf02hm4ww1p6lnbxg9-gatk-4.2.4.1/bin/gatk-package-4.2.4.1-local.jar!/com/intel/gkl/native/libgkl_utils.so
17:28:00.733 WARN  NativeLibraryLoader - Unable to load libgkl_utils.so from native/libgkl_utils.so (/Work/Users/apraga/bisonex/out/NA12878_NIST7035/preprocessing/applybqsr/libgkl_utils821485189051585397.so: libgomp.so.1: cannot open shared object file: No such file or directory)
17:28:00.733 WARN  IntelPairHmm - Intel GKL Utils not loaded
17:28:00.733 WARN  PairHMM - ***WARNING: Machine does not have the AVX instruction set support needed for the accelerated AVX PairHmm. Falling back to the MUCH slower LOGLESS_CACHING implementation!
17:28:00.763 INFO  ProgressMeter - Starting traversal
#+end_quote
libgomp.so est fourni par gcc donc il faut charger le module
 module load gcc@11.3.0/gcc-12.1.0
** KILL Utiliser subworkflow
CLOSED: [2023-04-02 Sun 18:08]
Notre version permet d'être plus souple
*** KILL Alignement
CLOSED: [2023-04-02 Sun 18:08] SCHEDULED: <2023-04-05 Wed>
*** KILL Vep
CLOSED: [2023-04-02 Sun 18:08] SCHEDULED: <2023-04-05 Wed>
vcf_annotate_ensemblvep
** TODO Annotation avec nextflow :annotation:
*** KILL VEP : --gene-phenotype ?
CLOSED: [2023-04-18 mar. 18:32]
Vu avec alexis : bases de données non à jour
https://www.ensembl.org/info/genome/variation/phenotype/sources_phenotype_documentation.html
*** DONE plugin VEP
CLOSED: [2023-04-18 mar. 18:32]
Cloner dépôt git avec plugin
Puis utiliser --dir_plugins
*** HOLD Utiliser code d’Alexis
*** TODO Nouvelle version avec VEP
Example avec --custom
https://www.ensembl.org/info/docs/tools/vep/script/vep_custom.html
**** DONE Ajout spliceAI
CLOSED: [2023-05-18 Thu 11:02] SCHEDULED: <2023-04-30 Sun>
plugin VEP
***** DONE Télécharger les données
CLOSED: [2023-05-11 Thu 19:01]
Difficile d'automatiser, le lien est temporaire...
***** DONE PLugin
CLOSED: [2023-05-11 Thu 20:16]
***** DONE Séparer score en plusieurs colonnes
CLOSED: [2023-05-11 Thu 20:16]
Test avec ce fichier pour avoir une ligne avec annotation et une ligne sans
#CHROM	POS	ID	REF	ALT
1	9091	.	A	C
1	69091	.	A	C
et
#+begin_src sh
rm -f postvep.tsv* && vep -i testspliceai.vcf.gz -o postvep.tsv --tab  --dir 109 --merged --pick --use_given_ref   --offline  --plugin SpliceAI,snv=spliceai_scores.raw.snv.hg38.vcf.gz,indel=spliceai_scores.raw.indel.hg38.vcf.gz
#+end_src
#+begin_src
$ bgzip postvep.tsv
$ python spliceai.py
$ cat postvep2.tsv
,variation,Location,Allele,Gene,Feature,Feature_type,Consequence,cDNA_position,CDS_position,Protein_position,Amino_acids,Codons,Existing_variation,IMPACT,DISTANCE,STRAND,FLAGS,REFSEQ_MATCH,SOURCE,REFSEQ_OFFSET,SpliceAI_AG,SpliceAI_AL,SpliceAI_DG,SpliceAI_DL
0,1_9091_A/C,1:9091,C,ENSG00000290825,ENST00000456328,Transcript,upstream_gene_variant,-,-,-,-,-,-,MODIFIER,2778,1,-,-,Ensembl,-,,,,
1,1_69091_A/C,1:69091,C,ENSG00000186092,ENST00000641515,Transcript,missense_variant,124,64,22,M/L,Atg/Ctg,-,MODERATE,-,1,-,-,Ensembl,-,0.01,0.00,0.00,0.01
#+end_src
Test
cp work/bf/437ae511958509e43072f032f4d495/small.tab.gz tests/vep-spip.tab.gz
cp work/d5/3b1244b5ae83d54409ee0d456e8c55/small_cadd.tab.gz tests/vep-cadd-splice.tab.gz
**** TODO Ajout LOEUF et pli
plugin VEP
**** TODO NMD
**** KILL Ajout LOEUF
CLOSED: [2023-04-19 mer. 16:32]
plugin VEP
**** DONE Spip
CLOSED: [2023-05-01 Mon 23:07] SCHEDULED: <2023-04-30 Sun>
BED ne semble pas bien marcher (il faut définir une zone)
VCF : trop d’information
Attention, plusieurs transcripts mais résultats identiques. On supprimer les doublons
***** DONE interpretation + score + intervalle de confiance séparé
CLOSED: [2023-05-01 Mon 23:07] SCHEDULED: <2023-04-30 Sun>
Tests :
dans

[5.8200]

[7.49917]

on=2.7
conda activate py2
conda install -c bioconda hap.py
#+end_src
******** Faire tourner les tests.
Il faut remplace bin/test_haplotypes par test_haplotypes dans src/sh/run_tests.sh
#+begin_src sh
 HGREF=../genome/GRCh38/GCA_000001405.15_GRCh38_no_alt_analysis_set.fasta HCDIR=~/anaconda3/envs/py2/bin bash src/sh/run_tests.sh
#+end_src
Echec:
test_haplotypes: /opt/conda/conda-bld/work/hap.py-0.3.7/src/c++/lib/tools/Fasta.cpp:81: MMappedFastaFile::MMappedFastaFile(const string&): Assertion `fd != -1' failed.
unknown location(0): fatal error in "testVariantPrimitiveSplitter": signal: SIGABRT (application abort requested)
/opt/conda/conda-bld/work/hap.py-0.3.7/src/c++/test/test_align.cpp(298): last checkpoint
******** Chr21
HGREF=../genome/GRCh38/GCA_000001405.15_GRCh38_no_alt_analysis_set.fasta hap.py        example/happy/PG_NA12878_chr21.vcf.gz       example/happy/NA12878_chr21.vcf.gz       -f example/happy/PG_Conf_chr21.bed.gz       -o test
******* Helios
échec
** TODO T2T :T2T:
Toutes les ressourcs sont décrites ici
https://github.com/marbl/CHM13
Détails sur le pipeline
https://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hub_3267197_GCA_009914755.4&c=CP068277.2&g=hub_3267197_hgLiftOver
*** DONE Alignement
CLOSED: [2023-06-26 Mon 19:42]
NXF_OPTS=-D"user.name=${USER}" nextflow run main.nf -profile standard,helios  --input="/Work/Groups/bisonex/data/giab/*_R{1,2}_001.fastq.gz" --id=NA12878-T2T -bg
SCHEDULED: <2023-06-14 Wed>
*** DONE Haplotypecaller
CLOSED: [2023-06-26 Mon 19:42] SCHEDULED: <2023-06-15 Thu>
*** TODO Filtres
SCHEDULED: <2023-07-16 Sun>
*** Liftover pipelines
:PROPERTIES:
:ID:       d2280207-3f65-4a31-a291-41fa9a9658c2
:END:
Contient les chain files
** TODO Indicateurs qualité
SCHEDULED: <2023-07-14 Fri>
*** Idée
Raredisease:
- FastQC : nombreuses statistiques. Non disponible Nix
- Mosdepth : calcule la profondeur (2x plus rapide que samtools depth). Nix
- MultiQC : fusionne juste les résultats des analyses. Non disponible nix
- Picard's CollectMutipleMetrics, CollectHsMetrics, and CollectWgsMetrics
- Qualimap : alternative fastqc ? Non disponible nix
- Sentieon's WgsMetricsAlgo : propriétaire
- TIDDIT's cov : TIDIT = remaninement chromosomique
Sarek:
- alignment statistics : samtools stats, mosdepth
- QC : MultiQC
MultiQC : non disponible Nix
** TODO vérifier si normalisation
SCHEDULED: <2023-07-14 Fri>
** TODO Rajouter vérification hgvs
SCHEDULED: <2023-07-14 Fri>
** DONE Exécution
CLOSED: [2022-09-13 Tue 21:37]
*** KILL test Bionix
*** KILL Implémenter execution avec Nix ?
Voir https://academic.oup.com/gigascience/article/9/11/giaa121/5987272?login=false
pour un exemple.
Probablement plus simple d’utiliser Nix pour gestion de l’environnement et snakemake pour l’exécution
Pas d’accès internet depuis le cluster
*** DONE nextflow
CLOSED: [2022-09-13 Tue 21:37]
**** TODO Bug scheduler SGE
Le job se fait tuer car l'utilisateur n'est pas passé correctement à nextflow
***** DONE Forcer l'utilisateur à l'exécution
CLOSED: [2023-04-01 Sat 17:57]
NXF_OPTS=-D"user.name=alex"
***** DONE Vérifier si le problème persiste avec 22.10.6
CLOSED: [2023-04-01 Sat 18:38] SCHEDULED: <2023-04-01 Sat>
oui
***** KILL Packager l'utilisateur dans le programme ?
Mauvaise idée..
** TODO Preprocessing avec nextflow
*** TODO Map to reference
**** TODO Sample ID dans header
/Work/Users/apraga/bisonex/out/63003856_S135/preprocessing/baserecalibrator
*** DONE Mark duplicate
CLOSED: [2022-10-09 Sun 22:30]
*** DONE Recalibrate base quality score
CLOSED: [2022-10-09 Sun 22:30]
** DONE Variant calling avec Nextflow
CLOSED: [2022-11-19 Sat 21:34]
*** DONE Haplotype caller
CLOSED: [2022-10-09 Sun 22:40]
*** DONE Filter variants
CLOSED: [2022-10-09 Sun 22:40]
*** DONE Filter common snp not clinvar path
CLOSED: [2022-11-07 Mon 23:00]
Voir [[*common dbSNP not clinvar patho][common dbSNP not clinvar patho]]
*** DONE Filter variant only in consensual sequence
CLOSED: [2022-11-08 Tue 22:23]
*** DONE Filter technical variants
CLOSED: [2022-11-19 Sat 21:34]
*** DONE Utilise AVX pour accélerer l'exécution
CLOSED: [2023-04-29 Sat 15:46]
Sans cela, on a l'avertissement
#+begin_quote
17:28:00.720 INFO  PairHMM - OpenMP multi-threaded AVX-accelerated native PairHMM implementation is not supported
17:28:00.721 INFO  NativeLibraryLoader - Loading libgkl_utils.so from jar:file:/nix/store/cy9ckxqwrkifx7wf02hm4ww1p6lnbxg9-gatk-4.2.4.1/bin/gatk-package-4.2.4.1-local.jar!/com/intel/gkl/native/libgkl_utils.so
17:28:00.733 WARN  NativeLibraryLoader - Unable to load libgkl_utils.so from native/libgkl_utils.so (/Work/Users/apraga/bisonex/out/NA12878_NIST7035/preprocessing/applybqsr/libgkl_utils821485189051585397.so: libgomp.so.1: cannot open shared object file: No such file or directory)
17:28:00.733 WARN  IntelPairHmm - Intel GKL Utils not loaded
17:28:00.733 WARN  PairHMM - ***WARNING: Machine does not have the AVX instruction set support needed for the accelerated AVX PairHmm. Falling back to the MUCH slower LOGLESS_CACHING implementation!
17:28:00.763 INFO  ProgressMeter - Starting traversal
#+end_quote
libgomp.so est fourni par gcc donc il faut charger le module
 module load gcc@11.3.0/gcc-12.1.0
** KILL Utiliser subworkflow
CLOSED: [2023-04-02 Sun 18:08]
Notre version permet d'être plus souple
*** KILL Alignement
CLOSED: [2023-04-02 Sun 18:08] SCHEDULED: <2023-04-05 Wed>
*** KILL Vep
CLOSED: [2023-04-02 Sun 18:08] SCHEDULED: <2023-04-05 Wed>
vcf_annotate_ensemblvep
** TODO Annotation avec nextflow :annotation:
*** KILL VEP : --gene-phenotype ?
CLOSED: [2023-04-18 mar. 18:32]
Vu avec alexis : bases de données non à jour
https://www.ensembl.org/info/genome/variation/phenotype/sources_phenotype_documentation.html
*** DONE plugin VEP
CLOSED: [2023-04-18 mar. 18:32]
Cloner dépôt git avec plugin
Puis utiliser --dir_plugins
*** HOLD Utiliser code d’Alexis
*** TODO Nouvelle version avec VEP
Example avec --custom
https://www.ensembl.org/info/docs/tools/vep/script/vep_custom.html
**** DONE Ajout spliceAI
CLOSED: [2023-05-18 Thu 11:02] SCHEDULED: <2023-04-30 Sun>
plugin VEP
***** DONE Télécharger les données
CLOSED: [2023-05-11 Thu 19:01]
Difficile d'automatiser, le lien est temporaire...
***** DONE PLugin
CLOSED: [2023-05-11 Thu 20:16]
***** DONE Séparer score en plusieurs colonnes
CLOSED: [2023-05-11 Thu 20:16]
Test avec ce fichier pour avoir une ligne avec annotation et une ligne sans
#CHROM	POS	ID	REF	ALT
1	9091	.	A	C
1	69091	.	A	C
et
#+begin_src sh
rm -f postvep.tsv* && vep -i testspliceai.vcf.gz -o postvep.tsv --tab  --dir 109 --merged --pick --use_given_ref   --offline  --plugin SpliceAI,snv=spliceai_scores.raw.snv.hg38.vcf.gz,indel=spliceai_scores.raw.indel.hg38.vcf.gz
#+end_src
#+begin_src
$ bgzip postvep.tsv
$ python spliceai.py
$ cat postvep2.tsv
,variation,Location,Allele,Gene,Feature,Feature_type,Consequence,cDNA_position,CDS_position,Protein_position,Amino_acids,Codons,Existing_variation,IMPACT,DISTANCE,STRAND,FLAGS,REFSEQ_MATCH,SOURCE,REFSEQ_OFFSET,SpliceAI_AG,SpliceAI_AL,SpliceAI_DG,SpliceAI_DL
0,1_9091_A/C,1:9091,C,ENSG00000290825,ENST00000456328,Transcript,upstream_gene_variant,-,-,-,-,-,-,MODIFIER,2778,1,-,-,Ensembl,-,,,,
1,1_69091_A/C,1:69091,C,ENSG00000186092,ENST00000641515,Transcript,missense_variant,124,64,22,M/L,Atg/Ctg,-,MODERATE,-,1,-,-,Ensembl,-,0.01,0.00,0.00,0.01
#+end_src
Test
cp work/bf/437ae511958509e43072f032f4d495/small.tab.gz tests/vep-spip.tab.gz
cp work/d5/3b1244b5ae83d54409ee0d456e8c55/small_cadd.tab.gz tests/vep-cadd-splice.tab.gz
**** TODO Ajout LOEUF et pli
plugin VEP
**** TODO NMD
**** KILL Ajout LOEUF
CLOSED: [2023-04-19 mer. 16:32]
plugin VEP
**** DONE Spip
CLOSED: [2023-05-01 Mon 23:07] SCHEDULED: <2023-04-30 Sun>
BED ne semble pas bien marcher (il faut définir une zone)
VCF : trop d’information
Attention, plusieurs transcripts mais résultats identiques. On supprimer les doublons
***** DONE interpretation + score + intervalle de confiance séparé
CLOSED: [2023-05-01 Mon 23:07] SCHEDULED: <2023-04-30 Sun>
Tests :
dans

Replacement in projects/bisonex.org at line 34 [4.35]

B:BD[2.8221] → [2.8221:10108]

∅:D[2.10108] → [8.8221:9613]

B:BD[8.8221] → [8.8221:9613]

∅:D[8.9613] → [9.8221:9688]

B:BD[9.8221] → [9.8221:9688]

∅:D[9.9688] → [7.66302:66714]

B:BD[7.66302] → [7.66302:66714]

∅:D[7.66714] → [10.9441:9527]

B:BD[10.9441] → [10.9441:9527]

∅:D[10.9527] → [11.8312:8560]

B:BD[11.8312] → [11.8312:8560]

∅:D[11.8560] → [12.32799:34055]

B:BD[12.32799] → [12.32799:34055]

∅:D[12.34055] → [3.32799:33560]

B:BD[3.32799] → [3.32799:33560]

∅:D[3.33560] → [13.48421:49104]

B:BD[13.48421] → [13.48421:49104]

        413       246       167          751       289        215      2     98       0.595642          0.460821        0.286285         0.519629                     NaN                     NaN                   2.428571                   2.465116
INDEL   PASS          413       246       167          751       289        215      2     98       0.595642          0.460821        0.286285         0.519629                     NaN                     NaN                   2.428571                   2.465116
SNP    ALL        15883     15479       404        23597      5277       2841     46     44       0.974564          0.745760        0.120397         0.844947                3.017198                 2.85705                   5.560099                   2.114633
SNP   PASS        15883     15479       404        23597      5277       2841     46     44       0.974564          0.745760        0.120397         0.844947                3.017198                 2.85705                   5.560099                   2.114633
******* DONE Vérifier qu'il ne reste plus de filtre autre que PASS
CLOSED: [2023-07-08 Sat 15:19]
#+begin_src
$ zgrep -c 'PASS' HG001_GRCh38_1_22_v4_lifted_merged.vcf.gz
3730505
$ zgrep -c '^chr' HG001_GRCh38_1_22_v4_lifted_merged.vcf.gz
3730506
#+end_src
****** TODO 1/4 SNP manquant ?
SCHEDULED: <2023-07-08 Sat>
******* DONE Regarder avec Julia si ce sont vraiment des FP: 61/5277 qui ne le sont pas
CLOSED: [2023-07-09 Sun 12:09]
 4155
******* TODO Tester un FP
******* TODO Vérifier quelques variants sur IGV
******* TODO Répartition des FP : cluster ?
******* TODO Examiner quelques FP
******* TODO Méthodologie du pangenome
***** KILL Mail Yannis
CLOSED: [2023-07-08 Sat 10:44]
***** DONE Mail GIAB pour version T2T
CLOSED: [2023-07-07 Fri 18:37]
**** DONE NA12878 :na12878:hg38:
CLOSED: [2023-06-30 Fri 22:30]
***** D
ONE Discussion alexis : Mail
CLOSED: [2023-03-29 Wed 22:40]
Avec le patient NA12878 et comparaison avec hap.py du VCF de Genome In A Bottle ("gold" standard), on avait pour rappel
- sensibilité (=recall) 71% pour indel, 85% SNP
- précision  (= VPP) 69 et 97% respectivement
| Type  | TRUTH |    TP |   FN | QUERY |   FP |  UNK | FP.gt | FP.al |   Recall | Precision |
| INDEL |  4871 |  3461 | 1410 |  7048 | 1554 | 1987 |   193 |   346 | 0.710532 |  0.692946 |
| SNP   | 46032 | 39369 | 6663 | 44600 | 1186 | 4041 |   304 |    30 | 0.855253 |  0.970759 |
Les statistiques sur les génomes sont bien meilleurs (cf precisionFDA challenge).
Pour les exome, un article [1] a fait a des meilleures stats sur ce patient avec BWA et GATK mais ils ont moins de variant (on a presque un facteur 2 !).
Je soupçonne qu'on ne travaille pas sur les mêmes zones de capture (pas réussi à récupérer leur .bed)
| Exome | Type  |    TP |   FP |  FN | Sensitivity | Precision | F-Score |   FDR |
|     1 | SNV   | 23689 | 1397 | 613 |       0.975 |     0.944 |   0.959 | 0.057 |
|     2 | SNV   | 23946 |  865 | 356 |       0.985 |     0.965 |   0.975 | 0.036 |
|     1 | indel |  1254 |   72 |  75 |       0.944 |     0.946 |   0.945 | 0.054 |
|     2 | indel |  1309 |   10 |  20 |       0.985 |     0.992 |   0.989 | 0.008 |
Pour essayer d'améliorer les statistiques :
- La version du génome GRC38 vs GRCh38.p13 ne change quasiment rien
- Désactiver dbSNP ne change strictement rien pour le variant calling
J'ai exploré les faux négatifs :
- la grande majorité n'est juste pas vue (ce n'est pas un problème d'haploïde/génotype)
- la répartition par chromosome est relativement homogène, sauf sur le 6 ()
- la majorité est en 5' et 3'UTR (selon Best refseq)
Conclusion: je pense m'arrêter là pour la validation du variant calling par manque de temps. Il faudrait creuser pour savoir pourquoi certains variants ne sont pas vus par GATK mais ce n'est pas la majorité. En tout cas, je peux justifier d'une première analyse pour la thèse.
Ça te va ?
[1]
https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-019-2928-9
Résultats ici https://static-content.springer.com/esm/art%3A10.1186%2Fs12859-019-2928-9/MediaObjects/12859_2019_2928_MOESM8_ESM.pdf
***** DONE Comparaison
CLOSED: [2023-03-04 Sat 11:14]
HGREF=/Work/Groups/bisonex/data-alexis-reference/genome/GRCh38_latest_genomic.fna ./result/bin/hap.py /Work/Groups/bisonex/NA12878/HG001_GRCh38_1_22_v4.2.1
_benchmark_renamed.vcf.gz script/files/vcf/NA12878_NIST7035_vep_annot.vcf -f /Work/Groups/bison
ex/NA12878/HG001_GRCh38_1_22_v4.2.1_benchmark.bed -o test
na1878.slurm
#+begin_src slurm
#!/bin/bash
#SBATCH -c 4
#SBATCH -p smp
#SBATCH --time=01:00:00
#SBATCH --mem=32G
module load nix/2.11.0
export HGREF=/Work/G
roups/bisonex/data-alexis-reference/genome/GRCh38_latest_genomic.fna
dir=/Work/Groups/bisonex/data/NA12878/GRCh38
hap.py ${dir}/HG001_GRCh38_1_22_v4.2.1_benchmark.vcf.gz script/files/vcf/NA12878_NIST7035.vcf -f ${dir}/HG001_GRCh38_1_22_v4.2.1_benchmark.bed -o test
#+end_src
****** KILL beaucoup trop de faux négatifs
CLOSED: [2023-02-17 Fri 19:37]
******* DONE Test 1 : vep annot : beaucoup trop de faux 
négatif
CLOSED: [2023-02-06 lun. 13:40]
 Type Filter  TRUTH.TOTAL  TRUTH.TP  TRUTH.
FN  QUERY.TOTAL  QUERY.FP  QUERY.UNK  FP.gt  FP.al  METRIC.Recall  METRIC.Precision  METRIC.Frac_NA  METRIC.F1_Score  TRUTH.TOTAL.TiTv_ratio  QUERY.TOTAL.TiTv_ratio  TRUTH.TOTAL.het_hom_ratio  QUERY.TOTAL.het_hom_ratio
INDEL    ALL       276768   
    274    276494         1500       257        968     26     15       0.000990          0.516917        0.645333         0.001976                     NaN                     NaN                   1.483361                   6.129187
INDEL   PASS       276768       274    276494         1500       257        968     26     15       0.000990          0.516917        0.645333         0.001976                     NaN                     NaN                   1.483361                   6.129187
  SNP    ALL      1937706      1193   1936513         3338       106       2037     11      2       0.000616          0.918524        0.610246         0.001231                  2.0785                1.861183                   1.539064                   2.703663
  SNP   PASS      1937706      1193   1936513         3338       106       2037     11      2       0.000616          0.918524        0.610246         0.001231                  2.0785                1.861183                   1.539064                   2.703663
******* KILL Test 3 : indexer vcf de reference
CLOSED: [2023-02-06 lun. 17:19]
Même résultat avec vcfeval, qui a besoin de la version indexée
******* DONE Test 3 sans filtre vep : idem
CLOSED: [2023-02-06 lun. 17:19]
Benchma
rking Summary:
 Type Filter  TRUTH.TOTAL  TRUTH.TP  TRUTH.FN  QUERY.TOTAL  QUERY.FP  QUERY.UNK  FP.gt  FP.al  METRIC.Recall  METRIC.Precision  METRIC.Frac_NA  METRIC.F1_Score  TRUTH.TOTAL.TiTv_ratio  QUERY.TOTAL.TiTv_ratio  TRUTH.TOTAL.het_hom_ratio  QUERY.TOTAL.het_hom_ratio
INDEL    ALL       276768     10535    266233        52169     10969      30616   3552   2122       0.038064          0.491069        0.586862         0.070652                     NaN                     NaN                   1.483361                   0.509510
INDEL   PASS       276768     10535    266233        52169     10969      30616   3552   2122       0.038064          0.491069        0.586862         0.070652                     NaN                     NaN            
       1.483361                   0.509510
  SNP    ALL      1937706    105753   1831953       357652     74634     177259  35111    797       0.054576          0.586270        0.495619         0.099857                  2.0785                 1.42954                   1.539064                   0.324923
  SNP   PASS      1937706    105753   1831953       357652     74634     177259  35111    797       0.054576          0.586270        0.495619         0.099857                  2.0785                 1.42954                   1.539064                   0.324923
******* DONE Test 4 avec vcfeval sur vep_annot : idem
CLOSED: [2023-02-06 lun. 17:18]
#+begin_src
#!/bin/bash

[2.8221]

[13.49104]

        413       246       167          751       289        215      2     98       0.595642          0.460821        0.286285         0.519629                     NaN                     NaN                   2.428571                   2.465116
INDEL   PASS          413       246       167          751       289        215      2     98       0.595642          0.460821        0.286285         0.519629                     NaN                     NaN                   2.428571                   2.465116
SNP    ALL        15883     15479       404        23597      5277       2841     46     44       0.974564          0.745760        0.120397         0.844947                3.017198                 2.85705                   5.560099                   2.114633
SNP   PASS        15883     15479       404        23597      5277       2841     46     44       0.974564          0.745760        0.120397         0.844947                3.017198                 2.85705                   5.560099                   2.114633
******* DONE Vérifier qu'il ne reste plus de filtre autre que PASS
CLOSED: [2023-07-08 Sat 15:19]
#+begin_src
$ zgrep -c 'PASS' HG001_GRCh38_1_22_v4_lifted_merged.vcf.gz
3730505
$ zgrep -c '^chr' HG001_GRCh38_1_22_v4_lifted_merged.vcf.gz
3730506
#+end_src
****** TODO 1/4 SNP manquant ?
SCHEDULED: <2023-07-08 Sat>
******* DONE Regarder avec Julia si ce sont vraiment des FP: 61/5277 qui ne le sont pas
CLOSED: [2023-07-09 Sun 12:09]
******* TODO Examiner les FP
******* TODO Tester un FP
  2 │ chr1        608765  A           G           ./.:.:.:.:NOCALL:nocall:.  1/1:FP:.:ti:SNP:homalt:188
  liftDown UCSC: rien en GIAB : vrai FP
 3 │ chr1        762943  A           G           ./.:.:.:.:NOCALL:nocall:.  1/1:FP:.:ti:SNP:homalt:287
 4 │ chr1        762945  A           T           ./.:.:.:.:NOCALL:nocall:.  1/1:FP:.:tv:SNP:homalt:287
 Remaniements complexes ? Pas dans le gène en HG38
******* TODO La plupart des FP (4705/5566) sont homozygotes: erreur de référence ?
SCHEDULED: <2023-07-09 Sun>
Sur les 2 premiers variants, ils montrent en fait la différence entre T2T et GRCh38
Erreur à l'alignement ?
******** KILL relancer l'alignement
CLOSED: [2023-07-09 Sun 17:36]
******** DONE vérifier reads identiques hg38 et T2T: oui
CLOSED: [2023-07-09 Sun 16:36]
T2T CHR1608765
38   	chr1:1180168-1180168 (
SRR14724513.24448214
SRR14724513.24448214
******* TODO Enlever les FP qui correspondent à un changement dans le génome
SCHEDULED: <2023-07-09 Sun>
Condition:
- pas de variation à la position en GRCh38
- variantion homozygote
- la varation en T2T correspond au changement de pair de base GRC38 -> T2T
  pour les SNP:
  alt_T2T[i] = DNA_GRC38[j]
  avec i la position en T2T et j la position en GRCh38
  Algorithm
  1. Définir un ID sur le VCF en hg38 :
      bcftools annotate --set-id +'hg38\_%CHROM\_%POS\_%REF\_%FIRST_ALT' file.vcf
  2. Pour chaque FP, récupérer depuis le VCF généré par happy
     - l'identifiant en hg38
     - les coordonnées en T2T
     - séquence alternative
  3. Pour chaque identifiant, récupérer depuis le VCF en hg38
     - séquence de réference
     - les coordonnées
  4. Comparer ALT en T2T à la REF en hg38
******* DONE Vérifier quelques variants sur IGV
CLOSED: [2023-07-09 Sun 17:36]
******* KILL Répartition des FP : cluster ?
CLOSED: [2023-07-09 Sun 17:36]
******* TODO Méthodologie du pangenome
***** KILL Mail Yannis
CLOSED: [2023-07-08 Sat 10:44]
***** DONE Mail GIAB pour version T2T
CLOSED: [2023-07-07 Fri 18:37]
**** DONE NA12878 :na12878:hg38:
CLOSED: [2023-06-30 Fri 22:30]
***** DONE Discussion alexis : Mail
CLOSED: [2023-03-29 Wed 22:40]
Avec le patient NA12878 et comparaison avec hap.py du VCF de Genome In A Bottle ("gold" standard), on avait pour rappel
- sensibilité (=recall) 71% pour indel, 85% SNP
- précision  (= VPP) 69 et 97% respectivement
| Type  | TRUTH |    TP |   FN | QUERY |   FP |  UNK | FP.gt | FP.al |   Recall | Precision |
| INDEL |  4871 |  3461 | 1410 |  7048 | 1554 | 1987 |   193 |   346 | 0.710532 |  0.692946 |
| SNP   | 46032 | 39369 | 6663 | 44600 | 1186 | 4041 |   304 |    30 | 0.855253 |  0.970759 |
Les statistiques sur les génomes sont bien meilleurs (cf precisionFDA challenge).
Pour les exome, un article [1] a fait a des meilleures stats sur ce patient avec BWA et GATK mais ils ont moins de variant (on a presque un facteur 2 !).
Je soupçonne qu'on ne travaille pas sur les mêmes zones de capture (pas réussi à récupérer leur .bed)
| Exome | Type  |    TP |   FP |  FN | Sensitivity | Precision | F-Score |   FDR |
|     1 | SNV   | 23689 | 1397 | 613 |       0.975 |     0.944 |   0.959 | 0.057 |
|     2 | SNV   | 23946 |  865 | 356 |       0.985 |     0.965 |   0.975 | 0.036 |
|     1 | indel |  1254 |   72 |  75 |       0.944 |     0.946 |   0.945 | 0.054 |
|     2 | indel |  1309 |   10 |  20 |       0.985 |     0.992 |   0.989 | 0.008 |
Pour essayer d'améliorer les statistiques :
- La version du génome GRC38 vs GRCh38.p13 ne change quasiment rien
- Désactiver dbSNP ne change strictement rien pour le variant calling
J'ai exploré les faux négatifs :
- la grande majorité n'est juste pas vue (ce n'est pas un problème d'haploïde/génotype)
- la répartition par chromosome est relativement homogène, sauf sur le 6 ()
- la majorité est en 5' et 3'UTR (selon Best refseq)
Conclusion: je pense m'arrêter là pour la validation du variant calling par manque de temps. Il faudrait creuser pour savoir pourquoi certains variants ne sont pas vus par GATK mais ce n'est pas la majorité. En tout cas, je peux justifier d'une première analyse pour la thèse.
Ça te va ?
[1]
https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-019-2928-9
Résultats ici https://static-content.springer.com/esm/art%3A10.1186%2Fs12859-019-2928-9/MediaObjects/12859_2019_2928_MOESM8_ESM.pdf
***** DONE Comparaison
CLOSED: [2023-03-04 Sat 11:14]
HGREF=/Work/Groups/bisonex/data-alexis-reference/genome/GRCh38_latest_genomic.fna ./result/bin/hap.py /Work/Groups/bisonex/NA12878/HG001_GRCh38_1_22_v4.2.1
_benchmark_renamed.vcf.gz script/files/vcf/NA12878_NIST7035_vep_annot.vcf -f /Work/Groups/bison
ex/NA12878/HG001_GRCh38_1_22_v4.2.1_benchmark.bed -o test
na1878.slurm
#+begin_src slurm
#!/bin/bash
#SBATCH -c 4
#SBATCH -p smp
#SBATCH --time=01:00:00
#SBATCH --mem=32G
module load nix/2.11.0
export HGREF=/Work/Groups/bisonex/data-alexis-reference/genome/GRCh38_latest_genomic.fna
dir=/Work/Groups/bisonex/data/NA12878/GRCh38
hap.py ${dir}/HG001_GRCh38_1_22_v4.2.1_benchmark.vcf.gz script/files/vcf/NA12878_NIST7035.vcf -f ${dir}/HG001_GRCh38_1_22_v4.2.1_benchmark.bed -o test
#+end_src
****** KILL beaucoup trop de faux négatifs
CLOSED: [2023-02-17 Fri 19:37]
******* DONE Test 1 : vep annot : beaucoup trop de faux négatif
CLOSED: [2023-02-06 lun. 13:40]
 Type Filter  TRUTH.TOTAL  TRUTH.TP  TRUTH.FN  QUERY.TOTAL  QUERY.FP  QUERY.UNK  FP.gt  FP.al  METRIC.Recall  METRIC.Precision  METRIC.Frac_NA  METRIC.F1_Score  TRUTH.TOTAL.TiTv_ratio  QUERY.TOTAL.TiTv_ratio  TRUTH.TOTAL.het_hom_ratio  QUERY.TOTAL.het_hom_ratio
INDEL    ALL       276768       274    276494         1500       257        968     26     15       0.000990          0.516917        0.645333         0.001976                     NaN                     NaN                   1.483361                   6.129187
INDEL   PASS       276768       274    276494         1500       257        968     26     15       0.000990          0.516917        0.645333         0.001976                     NaN                     NaN                   1.483361                   6.129187
  SNP    ALL      1937706      1193   1936513         3338       106       2037     11      2       0.000616          0.918524        0.610246         0.001231                  2.0785                1.861183                   1.539064                   2.703663
  SNP   PASS      1937706      1193   1936513         3338       106       2037     11      2       0.000616          0.918524        0.610246         0.001231                  2.0785                1.861183                   1.539064                   2.703663
******* KILL Test 3 : indexer vcf de reference
CLOSED: [2023-02-06 lun. 17:19]
Même résultat avec vcfeval, qui a besoin de la version indexée
******* DONE Test 3 sans filtre vep : idem
CLOSED: [2023-02-06 lun. 17:19]
Benchmarking Summary:
 Type Filter  TRUTH.TOTAL  TRUTH.TP  TRUTH.FN  QUERY.TOTAL  QUERY.FP  QUERY.UNK  FP.gt  FP.al  METRIC.Recall  METRIC.Precision  METRIC.Frac_NA  METRIC.F1_Score  TRUTH.TOTAL.TiTv_ratio  QUERY.TOTAL.TiTv_ratio  TRUTH.TOTAL.het_hom_ratio  QUERY.TOTAL.het_hom_ratio
INDEL    ALL       276768     10535    266233        52169     10969      30616   3552   2122       0.038064          0.491069        0.586862         0.070652                     NaN                     NaN                   1.483361                   0.509510
INDEL   PASS       276768     10535    266233        52169     10969      30616   3552   2122       0.038064          0.491069        0.586862         0.070652                     NaN                     NaN                   1.483361                   0.509510
  SNP    ALL      1937706    105753   1831953       357652     74634     177259  35111    797       0.054576          0.586270        0.495619         0.099857                  2.0785                 1.42954                   1.539064                   0.324923
  SNP   PASS      1937706    105753   1831953       357652     74634     177259  35111    797       0.054576          0.586270        0.495619         0.099857                  2.0785                 1.42954                   1.539064                   0.324923
******* DONE Test 4 avec vcfeval sur vep_annot : idem
CLOSED: [2023-02-06 lun. 17:18]
#+begin_src
#!/bin/bash

Replacement in projects/bisonex.org at line 42 [4.35]

B:BD[7.86133] → [7.86133:91204]

∅:D[7.91204] → [10.31110:34226]

B:BD[10.31110] → [10.31110:34226]

∅:D[10.34226] → [14.21603:21608]

B:BD[14.21603] → [14.21603:21608]

UERY.TOTAL.het_hom_ratio
INDEL,ALL,413,246,167,751,289,215,2,93,0.595642,0.460821,0.286285,0.519629,,,2.4285714285714284,2.4651162790697674
INDEL,PASS,413,246,167,751,289,215,2,93,0.595642,0.460821,0.286285,0.519629,,,2.4285714285714284,2.4651162790697674
SNP,ALL,11236,10985,251,23597,9771,2841,26,58,0.977661,0.529245,0.120397,0.686734,3.1146100329549617,2.857049501715406,3.640644361833953,2.1146328578975173
SNP,PASS,11236,10985,251,23597,9771,2841,26,58,0.977661,0.529245,0.120397,0.686734,3.1146100329549617,2.857049501715406,3.640644361833953,2.1146328578975173
**** TODO HG002 :hg002:T2T:
**** TODO HG003 :hg003:T2T:
**** TODO HG004 :hg004:T2T:
**** TODO Résumer résultats pour Paul + article :resultats:hg38:
SCHEDULED: <2023-07-10 Mon>
Refaire résultats
**** TODO Plot : ashkenazim trio :hg38:
SCHEDULED: <2023-07-10 Mon>
/Entered on/ [2023-04-16 Sun 17:29]
Refaire résultats
*** KILL Platinum genome
CLOSED: [2023-06-14 Wed 22:37]
https://emea.illumina.com/platinumgenomes.html
*** TODO Séquencer NA12878
Discussion avec Paul : sous-traitant ne nous donnera pas les données, il faut commander l'ADN
**** DONE ADN commandé
CLOSED: [2023-06-30 Fri 22:29]
** TODO Insilico :centogene:
*** TODO tous les variants centogène
**** DONE Extraire liste des SNVs
CLOSED: [2023-04-22 Sat 17:32] SCHEDULED: <2023-04-17 Mon>
***** DONE Corriger manquant à la main
CLOSED: [2023-04-22 Sat 17:31]
La sortie est sauvegardé dans git-annex : variants_success.csv
***** DONE Automatique
CLOSED: [2023-04-22 Sat 17:31]
**** DONE Convert SNVs : transcript -> génomique
CLOSED: [2023-06-03 Sat 17:16]
***** DONE Variant_recoder
CLOSED: [2023-04-26 Wed 21:21] SCHEDULED: <2023-04-22 Sat>
****** KILL Haskell: 160 manquant : recoded-success.csv
CLOSED: [2023-04-25 Tue 18:32]
La liste des variants a été générée en Haskel   l et nettoyée à la main.
On générer une liste de variant pour variant_rec            oder et on soumet tout d'un coup.
[[file:~/recherche/bisonex/parsevariants/app/Main.hs][parsevariant]]
#+begin_src haskell
recodeVariant = do
  prepareVariantRecod   er "variant_success.csv" "renamed.csv"
  runVariantRecoder "renamed.csv" "recoded.json"
#+end_src
#+RESULTS:
: <interactive>:4:3-19: error:
:     Variable not in scope: runVariantRecoder :: String -> String -> t
: gh
Problème : 160 n'ont pas pu être lu sur 820, probablement à cause du numéro mineur de transcrit
La sortie est sauvegardé dans git-annex : variants-recoded-raw.json.
****** KILL Julia
CLOSED: [2023-04-25 Tue 18:32]
On regénère la liste de variant et on passe à Julia pour préparer l'appel en parallèle à variant recoder
[[file:~/recherche/bisonex/parsevariants/variantRecoder.jl][variantRecoder.jl]]
#+begin_src julia
setupVariantRecoder(unique(init), n)
#+end_src
Puis
#+begin_src sh
parallel -a parallel-recoder.sh --jobs 10
#+end_src
On récupère les résultats
#+begin_src julia
(fails, success) = mergeVariantRecoder(n)
CSV.write(fSuccess, success)
CSV.write(fFailures, fails)
#+end_src
Certains variants ne sont pas trouvé, donc on prépare un nouveau job en enlevant les versionrs mineures des transcrits
#+begin_src julia
# Cleanup json and txt
if isfile(fSuccess) && isfile(fFailures)
    foreach(rm, variantRecoderInput())
    foreach(rm, variantRecoderOutput())
end
redoFails(fFailures)
#+end_src
Puis
#+begin_src sh
parallel -a parallel-recoder.sh --jobs 3
#+end_src
Il manque encore 70 transcrits
***** DONE Julia avec mobidetails: recode-failures-mobidetails.csv
CLOSED: [2023-04-25 Tue 18:58]
Nouvelle stratégie : on essaie une fois variant recoder.
Pour tous les échecs, on utilise mobidetails (~170).
Si l'ID n'est pas trouvé, on incrémente le numéro de version 2 fois
***** DONE Reste une dizaine à corriger à la main
CLOSED: [2023-04-26 Wed 21:21]
- [X] certains transcrits ont juste été supprimé
- [X] Erreur de parsing, manque souvent un -
#+begin_src julia
lastTryMobidetails("recoded-failures-mobidetails.csv")
#+end_src
***** DONE Fusionner données
CLOSED: [2023-04-26 Wed 22:35]
#+begin_src julia
function mergeAllGenomic()
    dNew = mergeAll("recoded-success.csv",
                    "recoded-failures-mobidetails.csv",
                    "recoded-failures-mobidetails-redo.csv")
    dInit = @chain DataFrame(CSV.File("variant_success.csv")) begin
        @transform :transcript = :transcript .* ":" .* :coding .* :codingPos .* :codingChange
        @select :file :transcript :classification :zygosity
        @rename :classificationCentogene = :classification
    end
    dTmp = outerjoin(dInit, dNew, on = :transcript)
    CSV.write("variant_genomic.csv", dTmp)
end
fSuccess = "recoded-success.csv"
fFailures = "recoded-failures.csv"
# variantRecoder(fSuccess, fFailures)
# mobidetailsOnFailures(fFailures)
# lastTryMobidetails("recoded-failures-mobidetails.csv")
mergeAllGenomic()
#+end_src
***** DONE Formatter donner pour simuscop
CLOSED: [2023-04-28 Fri 11:55] SCHEDULE
D: <2023-04-26 Wed>
**** TODO Extraire liste des CNVs
SCHEDULED: <2023-04-17 Mon>
**** TODO Simuscop :simuscop:
***** DONE Entrainer le modèle sur 63003856/
CLOSED: [2023-04-29 Sat 19:56]
Relancer le modèle pour être sûr
***** DONE Générer fastq avec simuscop (del et ins seulement) 20x
CLOSED: [2023-04-28 Fri 23:35] SCHEDULED: <2023-04-22 Sat>
****** DONE Génerer un profile avec bed de centogène
CLOSED: [2023-04-28 Fri 11:54] SCHEDULED: <2023-04-22 Sat>
NA12878 mais à refaire avec un vrai séquencage
Voir [[*Centogène][Bed Centogène]] pour choix
****** DONE Générer les données en 20x
CLOSED: [2023-04-28 Fri 11:54] SCHEDULED: <2023-04-22 Sat>
capture de centogene
****** DONE Regénérer en supprimant les doublons
CLOSED: [2023-04-28 Fri 17:28]
***** DONE Quelle couverture ?
CLOSED: [2023-04-29 Sat 18:26]
ex sur chr11:16,014,966 où on a 11 reads dans la simulation contre 200 !
****** 200 est la plus proche
#+attr_html: :width 500px
[[./simuscop-200-chr1-1.png]]
#+attr_html: :width 500px
[[./simuscop-200-chr1-2.png]]
****** DONE 20x
CLOSED: [2023-04-29 Sat 15:38]
****** DONE 50x
CLOSED: [2023-04-29 Sat 15:38]
****** DONE 100x
CLOSED: [2023-04-29 Sat 15:39]
****** DONE 200x
CLOSED: [2023-04-29 Sat 15:39]
***** DONE Reads mal centrés sur des petits exons seuls
CLOSED: [2023-04-29 Sat 19:56] SCHEDULED: <2023-04-29 Sat>
Capture ok : [[https://genome-euro.ucsc.edu/cgi-bin/hgTracks?db=hg38&lastVirtModeType=default&lastVirtModeExtraState=&virtModeType=default&virtMode=0&nonVirtPosition=&position=chr1%3A153817168%2D153817824&hgsid=296556270_F4fkENLPXHXidi2oALXls2jxNH9l][UCSC]] (track noire)
Mais mauvaise répartitiopn
#+attr_html: :width 800px
[[./simuscop-error.png]]
À tester
- Problème de profile ?
  - mauvais patient ?
  - mauvaise génération ? -> comparer avec ceux donnés sur github
- nom des chromosomes ?
****** DONE [#A] Tester sur exon 6 GATAD2B pour NC_000001.11:g.153817496A>T
CLOSED: [2023-04-29 Sat 19:56] SCHEDULED: <2023-04-29 Sat>
******* DONE Configuration + Profile 63003856.profile: idem, mal centré
CLOSED: [2023-04-29 Sat 19:18]
Téléchargement des données
#+begin_src sh :dir ~/code/bisonex/test-simuscop
scp meso:/Work/Projects/bisonex/data/genome/GRCh38.p14/genomeRef.fna .
scp meso:Work/Projects/bisonex/data/simuscop/*.profile .
scp -r meso:/Work/Projects/bisonex/data/genome/GRCh38.p13/bwa .
#+end_src
On récupère l'exon (NB: org-mode ne lance pas le code...)
#+begin_src julia
using CSV,DataFramesMeta
d = CSV.read("VCGS_Exome_Covered_Targets_hg38_40.1MB_renamed.bed", header=false, delim="\t", DataFrame)
@subset d :Column1 .== "NC_000001.11" :Column2 .<= 153817496 :Column3 .>= 153817496
#+end_src
NC_000001.11  153817371  153817542
Génération du bed
#+begin_src sh :dir ~/code/bisonex/test-simuscop
echo -e "NC_000001.11\t153817371\t153817542" > gatad2b-exon6.bed
#+end_src
#+RESULTS:
Génération d'un variant
#+begin_src sh :dir ~/code/bisonex/test-simuscop
echo -e "s\tsingle\tNC_000001.11\t153817496\tA\tT\thet"> variant.txt
#+end_src
#+RESULT
S:

[7.86133]

[14.21608]

UERY.TOTAL.het_hom_ratio
INDEL,ALL,413,246,167,751,289,215,2,93,0.595642,0.460821,0.286285,0.519629,,,2.4285714285714284,2.4651162790697674
INDEL,PASS,413,246,167,751,289,215,2,93,0.595642,0.460821,0.286285,0.519629,,,2.4285714285714284,2.4651162790697674
SNP,ALL,11236,10985,251,23597,9771,2841,26,58,0.977661,0.529245,0.120397,0.686734,3.1146100329549617,2.857049501715406,3.640644361833953,2.1146328578975173
SNP,PASS,11236,10985,251,23597,9771,2841,26,58,0.977661,0.529245,0.120397,0.686734,3.1146100329549617,2.857049501715406,3.640644361833953,2.1146328578975173
**** TODO HG002 :hg002:T2T:
**** TODO HG003 :hg003:T2T:
**** TODO HG004 :hg004:T2T:
**** TODO Résumer résultats pour Paul + article :resultats:hg38:
SCHEDULED: <2023-07-16 Sun>
Refaire résultats
**** TODO Plot : ashkenazim trio :hg38:
SCHEDULED: <2023-07-16 Sun>
/Entered on/ [2023-04-16 Sun 17:29]
Refaire résultats
*** KILL Platinum genome
CLOSED: [2023-06-14 Wed 22:37]
https://emea.illumina.com/platinumgenomes.html
*** TODO Séquencer NA12878
Discussion avec Paul : sous-traitant ne nous donnera pas les données, il faut commander l'ADN
**** DONE ADN commandé
CLOSED: [2023-06-30 Fri 22:29]
** TODO Insilico :centogene:
*** TODO tous les variants centogène
**** DONE Extraire liste des SNVs
CLOSED: [2023-04-22 Sat 17:32] SCHEDULED: <2023-04-17 Mon>
***** DONE Corriger manquant à la main
CLOSED: [2023-04-22 Sat 17:31]
La sortie est sauvegardé dans git-annex : variants_success.csv
***** DONE Automatique
CLOSED: [2023-04-22 Sat 17:31]
**** DONE Convert SNVs : transcript -> génomique
CLOSED: [2023-06-03 Sat 17:16]
***** DONE Variant_recoder
CLOSED: [2023-04-26 Wed 21:21] SCHEDULED: <2023-04-22 Sat>
****** KILL Haskell: 160 manquant : recoded-success.csv
CLOSED: [2023-04-25 Tue 18:32]
La liste des variants a été générée en Haskel   l et nettoyée à la main.
On générer une liste de variant pour variant_rec            oder et on soumet tout d'un coup.
[[file:~/recherche/bisonex/parsevariants/app/Main.hs][parsevariant]]
#+begin_src haskell
recodeVariant = do
  prepareVariantRecod   er "variant_success.csv" "renamed.csv"
  runVariantRecoder "renamed.csv" "recoded.json"
#+end_src
#+RESULTS:
: <interactive>:4:3-19: error:
:     Variable not in scope: runVariantRecoder :: String -> String -> t
: gh
Problème : 160 n'ont pas pu être lu sur 820, probablement à cause du numéro mineur de transcrit
La sortie est sauvegardé dans git-annex : variants-recoded-raw.json.
****** KILL Julia
CLOSED: [2023-04-25 Tue 18:32]
On regénère la liste de variant et on passe à Julia pour préparer l'appel en parallèle à variant recoder
[[file:~/recherche/bisonex/parsevariants/variantRecoder.jl][variantRecoder.jl]]
#+begin_src julia
setupVariantRecoder(unique(init), n)
#+end_src
Puis
#+begin_src sh
parallel -a parallel-recoder.sh --jobs 10
#+end_src
On récupère les résultats
#+begin_src julia
(fails, success) = mergeVariantRecoder(n)
CSV.write(fSuccess, success)
CSV.write(fFailures, fails)
#+end_src
Certains variants ne sont pas trouvé, donc on prépare un nouveau job en enlevant les versionrs mineures des transcrits
#+begin_src julia
# Cleanup json and txt
if isfile(fSuccess) && isfile(fFailures)
    foreach(rm, variantRecoderInput())
    foreach(rm, variantRecoderOutput())
end
redoFails(fFailures)
#+end_src
Puis
#+begin_src sh
parallel -a parallel-recoder.sh --jobs 3
#+end_src
Il manque encore 70 transcrits
***** DONE Julia avec mobidetails: recode-failures-mobidetails.csv
CLOSED: [2023-04-25 Tue 18:58]
Nouvelle stratégie : on essaie une fois variant recoder.
Pour tous les échecs, on utilise mobidetails (~170).
Si l'ID n'est pas trouvé, on incrémente le numéro de version 2 fois
***** DONE Reste une dizaine à corriger à la main
CLOSED: [2023-04-26 Wed 21:21]
- [X] certains transcrits ont juste été supprimé
- [X] Erreur de parsing, manque souvent un -
#+begin_src julia
lastTryMobidetails("recoded-failures-mobidetails.csv")
#+end_src
***** DONE Fusionner données
CLOSED: [2023-04-26 Wed 22:35]
#+begin_src julia
function mergeAllGenomic()
    dNew = mergeAll("recoded-success.csv",
                    "recoded-failures-mobidetails.csv",
                    "recoded-failures-mobidetails-redo.csv")
    dInit = @chain DataFrame(CSV.File("variant_success.csv")) begin
        @transform :transcript = :transcript .* ":" .* :coding .* :codingPos .* :codingChange
        @select :file :transcript :classification :zygosity
        @rename :classificationCentogene = :classification
    end
    dTmp = outerjoin(dInit, dNew, on = :transcript)
    CSV.write("variant_genomic.csv", dTmp)
end
fSuccess = "recoded-success.csv"
fFailures = "recoded-failures.csv"
# variantRecoder(fSuccess, fFailures)
# mobidetailsOnFailures(fFailures)
# lastTryMobidetails("recoded-failures-mobidetails.csv")
mergeAllGenomic()
#+end_src
***** DONE Formatter donner pour simuscop
CLOSED: [2023-04-28 Fri 11:55] SCHEDULED: <2023-04-26 Wed>
**** TODO Extraire liste des CNVs
SCHEDULED: <2023-04-17 Mon>
**** TODO Simuscop :simuscop:
***** DONE Entrainer le modèle sur 63003856/
CLOSED: [2023-04-29 Sat 19:56]
Relancer le modèle pour être sûr
***** DONE Générer fastq avec simuscop (del et ins seulement) 20x
CLOSED: [2023-04-28 Fri 23:35] SCHEDULED: <2023-04-22 Sat>
****** DONE Génerer un profile avec bed de centogène
CLOSED: [2023-04-28 Fri 11:54] SCHEDULED: <2023-04-22 Sat>
NA12878 mais à refaire avec un vrai séquencage
Voir [[*Centogène][Bed Centogène]] pour choix
****** DONE Générer les données en 20x
CLOSED: [2023-04-28 Fri 11:54] SCHEDULED: <2023-04-22 Sat>
capture de centogene
****** DONE Regénérer en supprimant les doublons
CLOSED: [2023-04-28 Fri 17:28]
***** DONE Quelle couverture ?
CLOSED: [2023-04-29 Sat 18:26]
ex sur chr11:16,014,966 où on a 11 reads dans la simulation contre 200 !
****** 200 est la plus proche
#+attr_html: :width 500px
[[./simuscop-200-chr1-1.png]]
#+attr_html: :width 500px
[[./simuscop-200-chr1-2.png]]
****** DONE 20x
CLOSED: [2023-04-29 Sat 15:38]
****** DONE 50x
CLOSED: [2023-04-29 Sat 15:38]
****** DONE 100x
CLOSED: [2023-04-29 Sat 15:39]
****** DONE 200x
CLOSED: [2023-04-29 Sat 15:39]
***** DONE Reads mal centrés sur des petits exons seuls
CLOSED: [2023-04-29 Sat 19:56] SCHEDULED: <2023-04-29 Sat>
Capture ok : [[https://genome-euro.ucsc.edu/cgi-bin/hgTracks?db=hg38&lastVirtModeType=default&lastVirtModeExtraState=&virtModeType=default&virtMode=0&nonVirtPosition=&position=chr1%3A153817168%2D153817824&hgsid=296556270_F4fkENLPXHXidi2oALXls2jxNH9l][UCSC]] (track noire)
Mais mauvaise répartitiopn
#+attr_html: :width 800px
[[./simuscop-error.png]]
À tester
- Problème de profile ?
  - mauvais patient ?
  - mauvaise génération ? -> comparer avec ceux donnés sur github
- nom des chromosomes ?
****** DONE [#A] Tester sur exon 6 GATAD2B pour NC_000001.11:g.153817496A>T
CLOSED: [2023-04-29 Sat 19:56] SCHEDULED: <2023-04-29 Sat>
******* DONE Configuration + Profile 63003856.profile: idem, mal centré
CLOSED: [2023-04-29 Sat 19:18]
Téléchargement des données
#+begin_src sh :dir ~/code/bisonex/test-simuscop
scp meso:/Work/Projects/bisonex/data/genome/GRCh38.p14/genomeRef.fna .
scp meso:Work/Projects/bisonex/data/simuscop/*.profile .
scp -r meso:/Work/Projects/bisonex/data/genome/GRCh38.p13/bwa .
#+end_src
On récupère l'exon (NB: org-mode ne lance pas le code...)
#+begin_src julia
using CSV,DataFramesMeta
d = CSV.read("VCGS_Exome_Covered_Targets_hg38_40.1MB_renamed.bed", header=false, delim="\t", DataFrame)
@subset d :Column1 .== "NC_000001.11" :Column2 .<= 153817496 :Column3 .>= 153817496
#+end_src
NC_000001.11  153817371  153817542
Génération du bed
#+begin_src sh :dir ~/code/bisonex/test-simuscop
echo -e "NC_000001.11\t153817371\t153817542" > gatad2b-exon6.bed
#+end_src
#+RESULTS:
Génération d'un variant
#+begin_src sh :dir ~/code/bisonex/test-simuscop
echo -e "s\tsingle\tNC_000001.11\t153817496\tA\tT\thet"> variant.txt
#+end_src
#+RESULTS:

Replacement in projects/bisonex.org at line 54 [4.35]

B:BD[7.94326] → [7.94326:95059]

GCTGTGGTCTCAGTGCCACCGATCAGGAGGTCCACTGCAGCCATGTGCAAGTGCCCTTCCAGGAGCTGTCCAGAGCCCTCT
+
FFFFFFFFFFFFFFFFFFFFFFF:FFF:FFFFFFFFFFFFF,FFFFFFFFFFFF:F:FFFF:FFFFF,,FFF:FFFFFFFFFF,FFFFFFF,FFFFFFFFFFF,FFFFFFFFF:FFFF,F:FFFFF:FFFFFFFFF:FFFF,FFFFFFFFF
******* DONE Supprimer NW_ et NT_
***** TODO Phase 2 : chr22, vaf variable :T2T:
SCHEDULED: <2023-07-10 Mon>
****** TODO Phase 3 : tous SNV, vaf variable :T2T:
SCHEDULED: <2023-07-14 Fri>
***** TODO Test Indel
**** Divers
***** DONE Vérifier nombre de reads fastq - bam
CLOSED: [2022-10-09 Sun 22:31]
*** KILL Liste varants "clinically relevent" (Clinge - CT-R d)
CLOSED: [2023-06-25 Sun 15:53] SCHEDULED: <2023-06-25 Sun>
[cite:@wilcox2021]
Vu avec alexis: pas notre cas d'usage

[7.94326]

GCTGTGGTCTCAGTGCCACCGATCAGGAGGTCCACTGCAGCCATGTGCAAGTGCCCTTCCAGGAGCTGTCCAGAGCCCTCT
+
FFFFFFFFFFFFFFFFFFFFFFF:FFF:FFFFFFFFFFFFF,FFFFFFFFFFFF:F:FFFF:FFFFF,,FFF:FFFFFFFFFF,FFFFFFF,FFFFFFFFFFF,FFFFFFFFF:FFFF,F:FFFFF:FFFFFFFFF:FFFF,FFFFFFFFF
******* DONE Supprimer NW_ et NT_
***** TODO Phase 2 : chr22, vaf variable :T2T:
SCHEDULED: <2023-07-16 Sun>
****** TODO Phase 3 : tous SNV, vaf variable :T2T:
SCHEDULED: <2023-07-14 Fri>
***** TODO Test Indel
**** Divers
***** DONE Vérifier nombre de reads fastq - bam
CLOSED: [2022-10-09 Sun 22:31]
*** KILL Liste varants "clinically relevent" (Clinge - CT-R d)
CLOSED: [2023-06-25 Sun 15:53] SCHEDULED: <2023-06-25 Sun>
[cite:@wilcox2021]
Vu avec alexis: pas notre cas d'usage