apraga/org - Change XZOQO7A5LE72EEGJRR6USUXL4S4L5DKQAHPJMUPXHF2MKLK4AK5AC

IST update

Created by Alexis Praga on August 3, 2023

XZOQO7A5LE72EEGJRR6USUXL4S4L5DKQAHPJMUPXHF2MKLK4AK5AC

Dependencies

In channels

main

Change contents

Replacement in projects/bisonex.org at line 3 [8.35]

B:BD[6.16390] → [7.29:8221]

l#downloadAlt
- alt = séquences alternatives (utilisables)
- fix = patch (correction ou amélioration)
- random = séquence connue sur un chromosome mais non encore utilisée
** Pipelines prêt-à-l’emploi nextflow
Problème : nécessite singularity ou docker (ou conda)
Potentiellement utilisable avec nix...
** Validation : Quelles données de référence ?
Discussion avec Alexis
- Platinum genomes = génome seul
*** [[https://github.com/genome-in-a-bottle/giab_data_indexes][Genome in a bottle]]
  - NA12878 :
    - Illumina HiSeq Exome : fastq + capture en hg37
    - Illumina TruSeq Exome : bam, pas de capture
    - Exomes en hg37 https://zenodo.org/record/3597727 avec capture
      - HiSeq2000
      - NextSeq 500
      - HiSeq 2500
  - HG002,3,4
    - Illumina Whole Exome  : bam. le kit de capture est "Agilent SureSelect Human All Exon V5 kit" selon [[https://ftp-trace.ncbi.nlm.nih.gov/giab/ftp/data/AshkenazimTrio/analysis/OsloUniversityHospital_Exome_GATK_jointVC_11242015/README.txt][README]]. On il faut les régions [[https://kb.10xgenomics.com/hc/en-us/articles/115004150923-Where-can-I-find-the-Agilent-Target-BED-files-][selon ce site]]
      Un autre fichier est disponible (capture ???)
    https://ftp-trace.ncbi.nlm.nih.gov/giab/ftp/data/AshkenazimTrio/analysis/OsloUniversityHospital_Exome_GATK_jointVC_11242015/wex_Agilent_SureSelect_v05_b37.baits.slop50.merged.list
  "target region" +/- 50bp
    testé sur chr311780-312086 : ok
Autres technologies non adaptées au pipeline (vu avec Alexis)
*** [[https://www.illumina.com/platinumgenomes.html][Platinum genome
]] Que du génome « sequenced to 50x depth on a HiSeq 2000 system”
Genome possible
*** 1000 genomes
- intersection des capture + CCDS  [[id:b77e64fa-06a8-4ffa-8b5b-ab3fda684b61][Données brutes exome 1000 Genomes (fastq + capture)]]
- Broad instute : SureSelect human all exon v2 target capture kit : non disponible sur le site d'agilent (V6 ou plus)
*** Zone de capture
GIAB fourni le .bed pour l'exome . INfo : https://support.illumina.com/sequencing/sequencing_kits/nextera-rapid-capture-exome-kit/downloads.html
*** Valider la méthode
- 1000 genomes + SureSelect human all exon v2 target capture kit : non disponible sur le site d'agilent (V6 ou plus)
  https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-019-2928-9
- GIAB + liftover du fichire de capture en hg38
Ce qui est aussi fait par
https://bcbio-nextgen.readthedocs.io/en/stable/contents/germline_variants.html
Mais avec UCSC liftover
** Centogène
https://www.twistbioscience.com/node/23906
Bed non fourni pour exactement cette capture
On prend https://www.twistbioscience.com/resources/data-files/twist-alliance-vcgs-exome-401mb-bed-files
qui content la majeure partie
* Nixpkgs :nix:
** DONE GATK
CLOSED: [2023-05-06 Sat 08:51]
*** DONE [[https://github.com/NixOS/nixpkgs/pull/185819][Binaire]]
CLOSED: [2022-09-10 Sat 23:53] SCHEDULED: <2022-08-10 Wed>
/Entered on/ [2022-08-09 Tue 10:57]
PR submitted
*** KILL Corriger code pour utiliser source
CLOSED: [2022-09-11 Sun 22:05]
*** DONE Corriger PATH pour include java et python
CLOSED: [2022-10-11 Tue 11:46]
https://github.com/NixOS/nixpkgs/pull/191548
Review <2022-10-10 Mon> , corrigé dans la journée
*** DONE Update 4.3.0.0
CLOSED: [2023-04-13 Thu 09:01]
** TODO Nextflow
*** KILL version script seule
CLOSED: [2023-04-01 Sat 18:29]
Fix pour SGE et nextflow
https://github.com/NixOS/nixpkgs/issues/192396
*** KILL Version avec gradle
CLOSED: [2022-10-09 Sun 22:51]
*** TODO [[https://github.com/NixOS/nixpkgs/issues/192396][Bug report Version 22.10.6]]
**** Notes
Erreur :
ERROR: Cannot download nextflow required file -- make sure you can connect to the internet
Alternatively you can try to download this file:
    https://www.nextflow.io/releases/v22.10.6/nextflow-22.10.6-all.jar
and save it as:
    .//nix/store/md2b1ah4d7ivj82k8xxap30dmdci00pa-nextflow-22.10.6/bin/.nextflow-wrapped
Dans la mise à jour, il y a la création d'un environnement virtuel qui casse l'exécution de nextflow (besoin de télécharger)
Fix = désactiver
**** KILL Patch NXF_OFFLINE=true
CLOSED: [2023-07-02 Sun 11:02] SCHEDULED: <2023-06-11 Sun>
** TODO Multiqc
** TODO VEP :vep:
*** DONE [[https://github.com/NixOS/nixpkgs/pull/185691][BioPerl]]
SCHEDULED: <2022-08-10 Wed>
/Entered on/ [2022-08-09 Tue 10:57]
PR submitted
*** TODO BioDBBBigFile
:PROPERTIES:
:ORDERED:  t
:END:
/Entered on/ [2022-08-10 Wed 14:28]
On utilise la dernière version de kent, donc plus de problème.
PRête à être mergé. Rebase faite<2023-07-02 Sun>
**** DONE Version de kent déjà packagée : forcer version  335
CLOSED: [2023-07-02 Sun 11:20]
***** KILL [[https://github.com/NixOS/nixpkgs/pull/206991][Restore building kent 404]]
CLOSED: [2023-05-06 Sat 17:40]
Review faite <2023-03-26 Sun> , atteinte merge]
Relancé <2023-05-06 Sat>
Kent 446 n'a pas ce problème donc PR inutile
***** DONE [[https://github.com/NixOS/nixpkgs/pull/223411][Ajouter les header to package]] (inc folder)
CLOSED: [2023-05-08 Mon 10:18] SCHEDULED: <2023-05-07 Sun>
Review à faire
https://github.com/NixOS/nixpkgs/pull/223411
Corrigé et plus besoin de la PR précédente
***** KILL [[https://github.com/NixOS/nixpkgs/pull/186462][BioDBBBigFile]] avec ces 2 changements
CLOSED: [2023-07-02 Sun 11:20]
**** KILL Version de kent déjà packagée : 404
CLOSED: [2023-03-27 Mon 16:43]
Compile mais les tests de passent pas
**** DONE Modifier selon PR https://github.com/NixOS/nixpkgs/pull/186462
CLOSED: [2023-07-30 Sun 22:01] SCHEDULED: <2023-07-30 Sun 20:00>
:LOGBOOK:
CLOCK: [2023-07-30 Sun 19:13]--[2023-07-30 Sun 20:50] =>  1:37
:END:
Modification nécessaire pour kent :
- plus de patch
- suppression d'une boucle dans postPatch
On supprime aussi NIX_BUILD_TOP
*** DONE [[https://github.com/NixOS/nixpkgs/pull/186459][BioDBHTS]]
CLOSED: [2023-05-06 Sat 08:49] SCHEDULED: <2023-04-15 Sat>
/Entered on/ [2022-08-10 Wed 14:28]
Correction pour review faites <2022-10-10 Mon>
*** DONE [[https://github.com/NixOS/nixpkgs/pull/186464][BioExtAlign]]
CLOSED: [2022-10-22 Sat 12:43] SCHEDULED: <2022-08-10 Wed>
/Entered on/ [2022-08-10 Wed 14:28]
Review <2022-10-10 Mon>, correction dans la journée.
Correction 2e passe, attente
Impossible de faire marcher les tests Car il ne trouve pas le module Bio::Tools::Align, qui est dans un dossier ailleurs dans le dépôt. Même en compilant tout le dépôt, cela ne fonctionne pas... On skip les tests.
*** TODO VEP
** WAIT [[https://github.com/NixOS/nixpkgs/pull/230394][rtg-tools]] :vcfeval:
Soumis
** PROJ Package Spip
** TODO Happy :happy:
*** PROJ PR python 3 upstream
*** PROJ nixpkgs en l'état
** TODO Bamsurgeon
/Entered on/ [2023-05-13 Sat 19:11]
*** TODO Velvet
** TODO PR Picard avec option pour gérer la mémoire
Similaire à
https://github.com/bioconda/bioconda-recipes/blob/master/recipes/picard/picard.sh
** Julia :julia:
*** KILL XAM.jl: PR pour modification record :julia:
CLOSED: [2023-05-29 Mon 15:40] SCHEDULED: <2023-05-28 Sun>
/Entered on/ [2023-05-27 Sat 22:39]
*** TODO XAMscissors.jl :xamscissors:
Modification de la séquence dans BAM.
*Pas de mise à jour de CIGAR*
On convertit en fastq et on lance le pipeline pour "corriger"
#+begin_src sh
cd /home/alex/code/bisonex/out/63003856/preprocessing/mapped
samtools view 63003856_S135.bam NC_000022.11 -o 63003856_S135_chr22.bam
cd /home/alex/recherche/bisonex/code/BamScissors.jl
cp ~/code/bisonex/out/63003856/preprocessing/mapped/63003856_S135_chr22.bam .
samtools index 63003856_chr22.bam
#+end_src
Le script va modifier le bam, le trier et générer le fastq. !!!
Attention: ne pas oublier l'option -n !!!
#+begin_src sh
time julia --project=.. insertVariant.jl
scp 63003856_S135_chr22_{1,2}.fq.gz meso:/Work/Users/apraga/bisonex/tests/bamscissors/
#+end_src
**** WAIT Implémenter les SNV avec VAF :snv:
Stratégie :
1. calculer la profondeur sur les positions
2. créer un dictionnaire { nom du reads : position dataframe }
3. itérer sur tous les reads et changer ceux marqués
***** DONE

[6.16390]

[7.8221]

l#downloadAlt
- alt = séquences alternatives (utilisables)
- fix = patch (correction ou amélioration)
- random = séquence connue sur un chromosome mais non encore utilisée
** Pipelines prêt-à-l’emploi nextflow
Problème : nécessite singularity ou docker (ou conda)
Potentiellement utilisable avec nix...
** Validation : Quelles données de référence ?
Discussion avec Alexis
- Platinum genomes = génome seul
*** [[https://github.com/genome-in-a-bottle/giab_data_indexes][Genome in a bottle]]
  - NA12878 :
    - Illumina HiSeq Exome : fastq + capture en hg37
    - Illumina TruSeq Exome : bam, pas de capture
    - Exomes en hg37 https://zenodo.org/record/3597727 avec capture
      - HiSeq2000
      - NextSeq 500
      - HiSeq 2500
  - HG002,3,4
    - Illumina Whole Exome  : bam. le kit de capture est "Agilent SureSelect Human All Exon V5 kit" selon [[https://ftp-trace.ncbi.nlm.nih.gov/giab/ftp/data/AshkenazimTrio/analysis/OsloUniversityHospital_Exome_GATK_jointVC_11242015/README.txt][README]]. On il faut les régions [[https://kb.10xgenomics.com/hc/en-us/articles/115004150923-Where-can-I-find-the-Agilent-Target-BED-files-][selon ce site]]
      Un autre fichier est disponible (capture ???)
    https://ftp-trace.ncbi.nlm.nih.gov/giab/ftp/data/AshkenazimTrio/analysis/OsloUniversityHospital_Exome_GATK_jointVC_11242015/wex_Agilent_SureSelect_v05_b37.baits.slop50.merged.list
  "target region" +/- 50bp
    testé sur chr311780-312086 : ok
Autres technologies non adaptées au pipeline (vu avec Alexis)
*** [[https://www.illumina.com/platinumgenomes.html][Platinum genome
]] Que du génome « sequenced to 50x depth on a HiSeq 2000 system”
Genome possible
*** 1000 genomes
- intersection des capture + CCDS  [[id:b77e64fa-06a8-4ffa-8b5b-ab3fda684b61][Données brutes exome 1000 Genomes (fastq + capture)]]
- Broad instute : SureSelect human all exon v2 target capture kit : non disponible sur le site d'agilent (V6 ou plus)
*** Zone de capture
GIAB fourni le .bed pour l'exome . INfo : https://support.illumina.com/sequencing/sequencing_kits/nextera-rapid-capture-exome-kit/downloads.html
*** Valider la méthode
- 1000 genomes + SureSelect human all exon v2 target capture kit : non disponible sur le site d'agilent (V6 ou plus)
  https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-019-2928-9
- GIAB + liftover du fichire de capture en hg38
Ce qui est aussi fait par
https://bcbio-nextgen.readthedocs.io/en/stable/contents/germline_variants.html
Mais avec UCSC liftover
** Centogène
https://www.twistbioscience.com/node/23906
Bed non fourni pour exactement cette capture
On prend https://www.twistbioscience.com/resources/data-files/twist-alliance-vcgs-exome-401mb-bed-files
qui content la majeure partie
* Nixpkgs :nix:
** DONE GATK
CLOSED: [2023-05-06 Sat 08:51]
*** DONE [[https://github.com/NixOS/nixpkgs/pull/185819][Binaire]]
CLOSED: [2022-09-10 Sat 23:53] SCHEDULED: <2022-08-10 Wed>
/Entered on/ [2022-08-09 Tue 10:57]
PR submitted
*** KILL Corriger code pour utiliser source
CLOSED: [2022-09-11 Sun 22:05]
*** DONE Corriger PATH pour include java et python
CLOSED: [2022-10-11 Tue 11:46]
https://github.com/NixOS/nixpkgs/pull/191548
Review <2022-10-10 Mon> , corrigé dans la journée
*** DONE Update 4.3.0.0
CLOSED: [2023-04-13 Thu 09:01]
** TODO Nextflow
*** KILL version script seule
CLOSED: [2023-04-01 Sat 18:29]
Fix pour SGE et nextflow
https://github.com/NixOS/nixpkgs/issues/192396
*** KILL Version avec gradle
CLOSED: [2022-10-09 Sun 22:51]
*** TODO [[https://github.com/NixOS/nixpkgs/issues/192396][Bug report Version 22.10.6]]
**** Notes
Erreur :
ERROR: Cannot download nextflow required file -- make sure you can connect to the internet
Alternatively you can try to download this file:
    https://www.nextflow.io/releases/v22.10.6/nextflow-22.10.6-all.jar
and save it as:
    .//nix/store/md2b1ah4d7ivj82k8xxap30dmdci00pa-nextflow-22.10.6/bin/.nextflow-wrapped
Dans la mise à jour, il y a la création d'un environnement virtuel qui casse l'exécution de nextflow (besoin de télécharger)
Fix = désactiver
**** KILL Patch NXF_OFFLINE=true
CLOSED: [2023-07-02 Sun 11:02] SCHEDULED: <2023-06-11 Sun>
** TODO Multiqc
** TODO VEP :vep:
*** DONE [[https://github.com/NixOS/nixpkgs/pull/185691][BioPerl]]
SCHEDULED: <2022-08-10 Wed>
/Entered on/ [2022-08-09 Tue 10:57]
PR submitted
*** TODO BioDBBBigFile
:PROPERTIES:
:ORDERED:  t
:END:
/Entered on/ [2022-08-10 Wed 14:28]
On utilise la dernière version de kent, donc plus de problème.
PRête à être mergé. Rebase faite<2023-07-02 Sun>
**** DONE Version de kent déjà packagée : forcer version  335
CLOSED: [2023-07-02 Sun 11:20]
***** KILL [[https://github.com/NixOS/nixpkgs/pull/206991][Restore building kent 404]]
CLOSED: [2023-05-06 Sat 17:40]
Review faite <2023-03-26 Sun> , atteinte merge]
Relancé <2023-05-06 Sat>
Kent 446 n'a pas ce problème donc PR inutile
***** DONE [[https://github.com/NixOS/nixpkgs/pull/223411][Ajouter les header to package]] (inc folder)
CLOSED: [2023-05-08 Mon 10:18] SCHEDULED: <2023-05-07 Sun>
Review à faire
https://github.com/NixOS/nixpkgs/pull/223411
Corrigé et plus besoin de la PR précédente
***** KILL [[https://github.com/NixOS/nixpkgs/pull/186462][BioDBBBigFile]] avec ces 2 changements
CLOSED: [2023-07-02 Sun 11:20]
**** KILL Version de kent déjà packagée : 404
CLOSED: [2023-03-27 Mon 16:43]
Compile mais les tests de passent pas
**** DONE Modifier selon PR https://github.com/NixOS/nixpkgs/pull/186462
CLOSED: [2023-07-30 Sun 22:01] SCHEDULED: <2023-07-30 Sun 20:00>
:LOGBOOK:
CLOCK: [2023-07-30 Sun 19:13]--[2023-07-30 Sun 20:50] =>  1:37
:END:
Modification nécessaire pour kent :
- plus de patch
- suppression d'une boucle dans postPatch
On supprime aussi NIX_BUILD_TOP
*** DONE [[https://github.com/NixOS/nixpkgs/pull/186459][BioDBHTS]]
CLOSED: [2023-05-06 Sat 08:49] SCHEDULED: <2023-04-15 Sat>
/Entered on/ [2022-08-10 Wed 14:28]
Correction pour review faites <2022-10-10 Mon>
*** DONE [[https://github.com/NixOS/nixpkgs/pull/186464][BioExtAlign]]
CLOSED: [2022-10-22 Sat 12:43] SCHEDULED: <2022-08-10 Wed>
/Entered on/ [2022-08-10 Wed 14:28]
Review <2022-10-10 Mon>, correction dans la journée.
Correction 2e passe, attente
Impossible de faire marcher les tests Car il ne trouve pas le module Bio::Tools::Align, qui est dans un dossier ailleurs dans le dépôt. Même en compilant tout le dépôt, cela ne fonctionne pas... On skip les tests.
*** TODO VEP
** WAIT [[https://github.com/NixOS/nixpkgs/pull/230394][rtg-tools]] :vcfeval:
Soumis
** TODO Package Spip
SCHEDULED: <2023-08-03 Thu 18:00>
** TODO Happy :happy:
*** PROJ PR python 3 upstream
*** PROJ nixpkgs en l'état
** TODO Bamsurgeon
/Entered on/ [2023-05-13 Sat 19:11]
*** TODO Velvet
** TODO PR Picard avec option pour gérer la mémoire
Similaire à
https://github.com/bioconda/bioconda-recipes/blob/master/recipes/picard/picard.sh
** Julia :julia:
*** KILL XAM.jl: PR pour modification record :julia:
CLOSED: [2023-05-29 Mon 15:40] SCHEDULED: <2023-05-28 Sun>
/Entered on/ [2023-05-27 Sat 22:39]
*** TODO XAMscissors.jl :xamscissors:
Modification de la séquence dans BAM.
*Pas de mise à jour de CIGAR*
On convertit en fastq et on lance le pipeline pour "corriger"
#+begin_src sh
cd /home/alex/code/bisonex/out/63003856/preprocessing/mapped
samtools view 63003856_S135.bam NC_000022.11 -o 63003856_S135_chr22.bam
cd /home/alex/recherche/bisonex/code/BamScissors.jl
cp ~/code/bisonex/out/63003856/preprocessing/mapped/63003856_S135_chr22.bam .
samtools index 63003856_chr22.bam
#+end_src
Le script va modifier le bam, le trier et générer le fastq. !!!
Attention: ne pas oublier l'option -n !!!
#+begin_src sh
time julia --project=.. insertVariant.jl
scp 63003856_S135_chr22_{1,2}.fq.gz meso:/Work/Users/apraga/bisonex/tests/bamscissors/
#+end_src
**** WAIT Implémenter les SNV avec VAF :snv:
Stratégie :
1. calculer la profondeur sur les positions
2. créer un dictionnaire { nom du reads : position dataframe }
3. itérer sur tous les reads et changer ceux marqués
***** DONE

Replacement in projects/bisonex.org at line 8 [8.35]

B:BD[9.37612] → [10.484:16862]

∅:D[10.16862] → [9.53893:60303]

B:BD[9.53893] → [9.53893:60303]

∅:D[9.60303] → [6.57374:57505]

B:BD[6.57374] → [6.57374:57505]

∅:D[6.57505] → [11.30966:32623]

B:BD[11.30966] → [11.30966:32623]

-i 'POS=10652589' clinvar_chr20.vcf.gz -o clinvar_mwi.vcf.gz
bcftools index -f dbsnp_mwi.vcf.gz
bcftools index -f clinvar_mwi.vcf.gz
bcftools isec dbsnp_mwi.vcf.gz clinvar_mwi.vcf.gz -n=2
#+end_src
#+RESULTS:
Même en biallélique, ne fonctionne pas.
Chr 20
Avec les fichiers du teste précédent
#+begin_src sh :dir ~/code/bisonex/test_isec
bcftools norm -m -any dbsnp_mwi.vcf.gz -o dbsnp_mwi_norm.vcf.gz
bcftools index dbsnp_mwi_norm.vcf.gz
bcftools isec dbsnp_mwi_norm.vcf.gz clinvar_mwi.vcf.gz -n=2
#+end_src
#+RESULTS:
| NC_000020.11 | 10652589 | G | A | 11 |
| NC_000020.11 | 10652589 | G | C | 11 |
******* TODO Sur dbSNP chr20 non
#+begin_src sh :dir ~/code/bisonex/test_isec
bcftools norm -m -any dbSNP_common_chr20 -o dbSNP_common_chr20_norm.vcf.gz
#+end_src
#+begin_src sh :dir ~/code/bisonex/test_isec
bcftools isec -i 'INFO/CLNSIG="Pathogenic"' dbSNP_common_chr20_norm.vcf.gz clinvar_chr20.vcf.gz -p tmp
#+end_src
#+RESULTS:
***** DONE Essai bedtools intersect
#+begin_src sh
bedtools intersect -a  dbSNP_common.vcf.gz -b clinvar.vcf.gz
#+end_src
$ wc -l intersect.vcf
220206 intersect.vcf
** TODO Dépendences avec Nix
*** DONE GATK
CLOSED: [2022-10-21 Fri 21:59]
*** WAIT BioDBHTS
Contribuer pull request
*** DONE BioExtAlign
CLOSED: [2022-10-22 Sat 00:38]
*** WAIT BioBigFile
Revoir si on peut utliser kent dernière version
Contribuer pull request
*** HOLD rtg-tools
Convertir clinvar NC
*** DONE simuscop
CLOSED: [2022-12-30 Fri 22:31]
*** DONE Spip
CLOSED: [2022-12-04 Sun 12:49]
Pas de pull request
*** DONE R + packages
CLOSED: [2022-11-19 Sat 21:05]
*** TODO hap.py
https://github.com/Illumina/hap.py
**** DONE Version sans rtgtools avec python 3
CLOSED: [2023-02-02 Thu 22:15]
Procédure pour tester
#+begin_src
nix develop .#hap-py
$ genericBuild
#+end_src
1. Supprimer l’appel à make_dependencies dans cmakelist.txt : on peut tout installer avec nix
2. Patch Roc.cpp pour avoir numeric_limits ( error: 'numeric_limits' is not a member of 'std')
3. ajout de flags de link (essai, error)
set(ZLIB_LIBRARIES -lz -lbz2 -lcurl -lcrypto -llzma)
4. Changer les appels à print en print() dans le code python et suppression de quelques import
[nix-shell:~/source]$ sed -i.orig 's/print \"\(.*\)"/print(\1)/' src/python/*.py
**** DONE Sérialiser json pour écrire données de sorties
CLOSED: [2023-02-17 Fri 19:25]
**** DONE Tester sur example
CLOSED: [2023-02-04 Sat 00:25]
#+begin_src sh
$ cd hap.py
$ ../result/bin/hap.py example/happy/PG_NA12878_chr21.vcf.gz       example/happy/NA12878_chr21.vcf.gz       -f example/happy/PG_Conf_chr21.bed.gz       -o test -r example/chr21.fa
#+end_src
#+RESULTS:
| Type  | Filter | TRUTH.TOTAL | TRUTH.TP | TRUTH.FN | QUERY.TOTAL | QUERY.FP | QUERY.UNK | FP.gt | FP.al | METRIC.Recall | METRIC.Precision | METRIC.Frac_NA | METRIC.F1_Score |
| INDEL | ALL    |        8937 |     7839 |     1098 |       11812 |      343 |      3520 |    45 |   283 |      0.877140 |         0.958635 |       0.298002 |        0.916079 |
| INDEL | PASS   |        8937 |     7550 |     1387 |        9971 |      283 |      1964 |    30 |   242 |      0.844803 |         0.964656 |       0.196971 |        0.900760 |
| SNP   | ALL    |       52494 |    52125 |      369 |       90092 |      582 |     37348 |   107 |   354 |      0.992971 |         0.988966 |       0.414554 |        0.990964 |
| SNP   | PASS   |       52494 |    46920 |     5574 |       48078 |      143 |       992 |     8 |    97 |      0.893816 |         0.996963 |       0.020633 |        0.942576 |
**** KILL Version avec rtg-tools
CLOSED: [2023-07-30 Sun 14:38]
**** HOLD Faire fonctionner Tests
***** HOLD Essai 2 : depuis nix develop:
#+begin_src
nix develop .#hap-py
genericBuild
#+end_src
Lancé initialement à la main, mais on peut maintenant utiliser run_tests
#+begin_src
HCDIR=bin/ ../src/sh/run_tests.sha
#+end_src
- [X] test boost
- [X] multimerge
- [X] hapenum
- [X] fp accuracy
- [X] faulty variant
- leftshift fails
- [X] other vcf
- [X] chr prefix
- [X] gvcf
- [X] decomp
- [X] contig lengt
- [X]  integration test
- [ ] scmp fails sur le type
- [X] giab
- [X] performance
- [ ] quantify fails sur le type
- [ ] stratified échec sur les résultats !
- [X] pg counting
- [ ] sompy: ne trouve pas Strelka dans somatic
phases="buildPhase checkPhase installPhase fixupPhase" genericBuild
#+end_src
**** KILL Reproduire les performances precisionchallenge : attention à HG002 et HG001!
CLOSED: [2023-04-01 Sat 19:43]
https://www.nist.gov/programs-projects/genome-bottle
***** KILL 0GOOR
CLOSED: [2023-04-01 Sat 19:40]
Le problème venait 1. de l'ADN et 2. du renommage des chromosomes qui était faux
****** DONE HG002
CLOSED: [2023-02-17 Fri 19:31]
 Type Filter  TRUTH.TOTAL  TRUTH.TP  TRUTH.FN  QUERY.TOTAL  QUERY.FP  QUERY.UNK  FP.gt  FP.al  METRIC.Recall  METRIC.Precision  METRIC.Frac_NA  METRIC.F1_Score
INDEL    ALL       525466    491355     34111      1156702     57724     605307   9384  25027       0.935084          0.895313        0.523304         0.914766
INDEL   PASS       525466    491355     34111      1156702     57724     605307   9384  25027       0.935084          0.895313        0.523304         0.914766
  SNP    ALL      3365115   3358399      6716      5666020     21995    2284364   4194   1125       0.998004          0.993496        0.403169         0.995745
  SNP   PASS      3365115   3358399      6716      5666020     21995    2284364   4194   1125       0.998004          0.993496        0.403169         0.995745
 TRUTH.TOTAL.TiTv_ratio  QUERY.TOTAL.TiTv_ratio  TRUTH.TOTAL.het_hom_ratio  QUERY.TOTAL.het_hom_ratio
                    NaN                     NaN                   1.528276                   2.752637
                    NaN                     NaN                   1.528276                   2.752637
               2.100129                1.473519                   1.581196                   1.795603
               2.100129                1.473519                   1.581196                   1.795603
***** KILL Avec python2
CLOSED: [2023-02-17 Fri 19:25]
****** KILL avec nix
CLOSED: [2023-02-17 Fri 19:25]
conda create -n python2 python=2.7 anaconda
****** KILL avec conda
CLOSED: [2023-02-17 Fri 19:25]
******* Gentoo: regex_error sur test...
Ok avec bash !
#+begin_src
anaconda3/bin/conda create --name py2 python=2.7
conda activate py2
conda install -c bioconda hap.py
#+end_src
******** Faire tourner les tests.
Il faut remplace bin/test_haplotypes par test_haplotypes dans src/sh/run_tests.sh
#+begin_src sh
 HGREF=../genome/GRCh38/GCA_000001405.15_GRCh38_no_alt_analysis_set.fasta HCDIR=~/anaconda3/envs/py2/bin bash src/sh/run_tests.sh
#+end_src
Echec:
test_haplotypes: /opt/conda/conda-bld/work/hap.py-0.3.7/src/c++/lib/tools/Fasta.cpp:81: MMappedFastaFile::MMappedFastaFile(const string&): Assertion `fd != -1' failed.
unknown location(0): fatal error in "testVariantPrimitiveSplitter": signal: SIGABRT (application abort requested)
/opt/conda/conda-bld/work/hap.py-0.3.7/src/c++/test/test_align.cpp(298): last checkpoint
******** Chr21
HGREF=../genome/GRCh38/GCA_000001405.15_GRCh38_no_alt_analysis_set.fasta hap.py        example/happy/PG_NA12878_chr21.vcf.gz       example/happy/NA12878_chr21.vcf.gz       -f example/happy/PG_Conf_chr21.bed.gz       -o test
******* Helios
échec
** TODO T2T :T2T:
Toutes les ressourcs sont décrites ici
https://github.com/marbl/CHM13
Détails sur le pipeline
https://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hub_3267197_GCA_009914755.4&c=CP068277.2&g=hub_3267197_hgLiftOver
*** Liftover pipelines
:PROPERTIES:
:ID:       d2280207-3f65-4a31-a291-41fa9a9658c2
:END:
Contient les chain files
*** DONE Alignement
CLOSED: [2023-06-26 Mon 19:42]
NXF_OPTS=-D"user.name=${USER}" nextflow run main.nf -profile standard,helios  --input="/Work/Groups/bisonex/data/giab/*_R{1,2}_001.fastq.gz" --id=NA12878-T2T -bg
SCHEDULED: <2023-06-14 Wed>
*** DONE Haplotypecaller
CLOSED: [2023-06-26 Mon 19:42] SCHEDULED: <2023-06-15 Thu>
*** TODO Faire fonctionner les filtres avec vep
SCHEDULED: <2023-08-02 Wed>
*** PROJ Générer la base de donnée spip
*** PROJ Porter Spip
** PROJ Indicateurs qualité
*** Idée
Raredisease:
- FastQC : nombreuses statistiques. Non disponible Nix
- Mosdepth : calcule la profondeur (2x plus rapide que samtools depth). Nix
- MultiQC : fusionne juste les résultats des analyses. Non disponible nix
- Picard's CollectMutipleMetrics, CollectHsMetrics, and CollectWgsMetrics
- Qualimap : alternative fastqc ? Non disponible nix
- Sentieon's WgsMetricsAlgo : propriétaire
- TIDDIT's cov : TIDIT = remaninement chromosomique
Sarek:
- alignment statistics : samtools stats, mosdepth
- QC : MultiQC
MultiQC : non disponible Nix
** PROJ vérifier si normalisation
** PROJ Rajouter vérification hgvs
** DONE Exécution
CLOSED: [2022-09-13 Tue 21:37]
*** KILL test Bionix
*** KILL Implémenter execution avec Nix ?
Voir https://academic.oup.com/gigascience/article/9/11/giaa121/5987272?login=false
pour un exemple.
Probablement plus simple d’utiliser Nix pour gestion de l’environnement et snakemake pour l’exécution
Pas d’accès internet depuis le cluster
*** DONE nextflow
CLOSED: [2022-09-13 Tue 21:37]
**** TODO Bug scheduler SGE
Le job se fait tuer car l'utilisateur n'est pas passé correctement à nextflow
***** DONE Forcer l'utilisateur à l'exécution
CLOSED: [2023-04-01 Sat 17:57]
NXF_OPTS=-D"user.name=alex"
***** DONE Vérifier si le problème persiste avec 22.10.6
CLOSED: [2023-04-01 Sat 18:38] SCHEDULED: <2023-04-01 Sat>
oui
***** KILL Packager l'utilisateur dans le programme ?
Mauvaise idée..
** TODO Preprocessing avec nextflow
*** TODO Map to reference
**** TODO Sample ID dans header
/Work/Users/apraga/bisonex/out/63003856_S135/preprocessing/baserecalibrator
*** DONE Mark duplicate
CLOSED: [2022-10-09 Sun 22:30]
*** DONE Recalibrate base quality score
CLOSED: [2022-10-09 Sun 22:30]
** DONE Variant calling avec Nextflow
CLOSED: [2022-11-19 Sat 21:34]
*** DONE Haplotype caller
CLOSED: [2022-10-09 Sun 22:40]
*** DONE Filter variants
CLOSED: [2022-10-09 Sun 22:40]
*** DONE Filter common snp not clinvar path
CLOSED: [2022-11-07 Mon 23:00]
Voir [[*common dbSNP not clinvar patho][common dbSNP not clinvar patho]]
*** DONE Filter variant only in consensual sequence
CLOSED: [2022-11-08 Tue 22:23]
*** DONE Filter technical variants
CLOSED: [2022-11-19 Sat 21:34]
*** DONE Utilise AVX pour accélerer l'exécution
CLOSED: [2023-04-29 Sat 15:46]
Sans cela, on a l'avertissement
#+begin_quote
17:28:00.720 INFO  PairHMM - OpenMP multi-threaded AVX-accelerated native PairHMM implementation is not supported
17:28:00.721 INFO  NativeLibraryLoader - Loading libgkl_utils.so from jar:file:/nix/store/cy9ckxqwrkifx7wf02hm4ww1p6lnbxg9-gatk-4.2.4.1/bin/gatk-package-4.2.4.1-local.jar!/com/intel/gkl/native/libgkl_utils.so
17:28:00.733 WARN  NativeLibraryLoader - Unable to load libgkl_utils.so from native/libgkl_utils.so (/Work/Users/apraga/bisonex/out/NA12878_NIST7035/preprocessing/applybqsr/libgkl_utils821485189051585397.so: libgomp.so.1: cannot open shared object file: No such file or directory)
17:28:00.733 WARN  IntelPairHmm - Intel GKL Utils not loaded
17:28:00.733 WARN  PairHMM - ***WARNING: Machine does not have the AVX instruction set support needed for the accelerated AVX PairHmm. Falling back to the MUCH slower LOGLESS_CACHING implementation!
17:28:00.763 INFO  ProgressMeter - Starting traversal
#+end_quote
libgomp.so est fourni par gcc donc il faut charger le module
 module load gcc@11.3.0/gcc-12.1.0
** KILL Utiliser subworkflow
CLOSED: [2023-04-02 Sun 18:08]
Notre version permet d'être plus souple
*** KILL Alignement
CLOSED: [2023-04-02 Sun 18:08] SCHEDULED: <2023-04-05 Wed>
*** KILL Vep
CLOSED: [2023-04-02 Sun 18:08] SCHEDULED: <2023-04-05 Wed>
vcf_annotate_ensemblvep
** TODO Annotation avec nextflow :annotation:
*** KILL VEP : --gene-phenotype ?
CLOSED: [2023-04-18 mar. 18:32]
Vu avec alexis : bases de données non à jour
https://www.ensembl.org/info/genome/variation/phenotype/sources_phenotype_documentation.html
*** DONE plugin VEP
CLOSED: [2023-04-18 mar. 18:32]
Cloner dépôt git avec plugin
Puis utiliser --dir_plugins
*** HOLD Utiliser code d’Alexis
*** TODO Nouvelle version avec VEP
Example avec --custom
https://www.ensembl.org/info/docs/tools/vep/script/vep_custom.html
**** DONE Ajout spliceAI
CLOSED: [2023-05-18 Thu 11:02] SCHEDULED: <2023-04-30 Sun>
plugin VEP
***** DONE Télécharger les données
CLOSED: [2023-05-11 Thu 19:01]
Difficile d'automatiser, le lien est temporaire...
***** DONE PLugin
CLOSED: [2023-05-11 Thu 20:16]
***** DONE Séparer score en plusieurs colonnes
CLOSED: [2023-05-11 Thu 20:16]
Test avec ce fichier pour avoir une ligne avec annotation et une ligne sans
#CHROM	POS	ID	REF	ALT
1	9091	.	A	C
1	69091	.	A	C
et
#+begin_src sh
rm -f postvep.tsv* && vep -i testspliceai.vcf.gz -o postvep.tsv --tab  --dir 109 --merged --pick --use_given_ref   --offline  --plugin SpliceAI,snv=spliceai_scores.raw.snv.hg38.vcf.gz,indel=spliceai_scores.raw.indel.hg38.vcf.gz
#+end_src
#+begin_src
$ bgzip postvep.tsv
$ python spliceai.py
$ cat postvep2.tsv
,variation,Location,Allele,Gene,Feature,Feature_type,Consequence,cDNA_position,CDS_position,Protein_position,Amino_acids,Codons,Existing_variation,IMPACT,DISTANCE,STRAND,FLAGS,REFSEQ_MATCH,SOURCE,REFSEQ_OFFSET,SpliceAI_AG,SpliceAI_AL,SpliceAI_DG,SpliceAI_DL
0,1_9091_A/C,1:9091,C,ENSG00000290825,ENST00000456328,Transcript,upstream_gene_variant,-,-,-,-,-,-,MODIFIER,2778,1,-,-,Ensembl,-,,,,
1,1_69091_A/C,1:69091,C,ENSG00000186092,ENST00000641515,Transcript,missense_variant,124,64,22,M/L,Atg/Ctg,-,MODERATE,-,1,-,-,Ensembl,-,0.01,0.00,0.00,0.01
#+end_src
Test
cp work/bf/437ae511958509e43072f032f4d495/small.tab.gz tests/vep-spip.tab.gz
cp work/d5/3b1244b5ae83d54409ee0d456e8c55/small_cadd.tab.gz tests/vep-cadd-splice.tab.gz
**** TODO Package Nix spliceAI ?
nix profile install nixpkgs#python3Packages.tensorflow
+ ajouter dépendencs ("grep import" ou cnad)
**** TODO Ajout LOEUF et pli
plugin VEP
**** TODO NMD
**** KILL Ajout LOEUF
CLOSED: [2023-04-19 mer. 16:32]
plugin VEP
**** DONE Spip
CLOSED: [2023-05-01 Mon 23:07] SCHEDULED: <2023-04-30 Sun>
BED ne semble pas bien marcher (il faut définir une zone)
VCF : trop d’information
Attention, plusieurs transcripts mais résultats identiques. On supprimer les doublons
***** DONE interpretation + score + intervalle de confiance séparé
CLOSED: [2023-05-01 Mon 23:07] SCHEDULED: <2023-04-30 Sun>
Tests :
dans tests/
vep -i 63004925-small.vcf -o postvep.vcf --vcf --fasta genomeRef.fna --dir 109 --merged --pick  --offline --custom ../script/spip_annotation.vcf.gz,SPIP,vcf,exact,0,spipInterp,spipScore,spipConfidence
***** DONE Score
CLOSED: [2023-04-22 Sat 15:30]
**** DONE CADD: remplacer par plugin VEP
CLOSED: [2023-05-07 Sun 14:45] SCHEDULED: <2023-05-07 Sun>
***** Test
#+begin_src
vep  -i test.vcf  -o lol.vcf --offline --dir  /Work/Projects/bisonex/data/vep/GRCh38/ --merged --vcf --fasta /Work/Projects/bisonex/data/genome/GRCh38.p13/genomeRef.fna --plugin CADD,/Work/Users/apraga/bisonex/work/13/9287a7fef17ab9365f5696f20710cd/gnomad.genomes.r3.0.snv.tsv.gz,/Work/Users/apraga/bisonex/work/13/9287a7fef17ab9365f5696f20710cd/gnomad.genomes.r3.0.indel.tsv.gz  --dir_plugins ../VEP_plugins/ -v
#+end_src
Test
#+begin_src sh
vep --id "1  230710048 230710048 A/G 1"   --offline --dir  /Work/Projects/bisonex/data/vep/GRCh38/ --merged --vcf --fasta /Work/Projects/bisonex/data/genome/GRCh38.p13/genomeRef.fna --plugin CADD,/Work/Users/apraga/bisonex/work/13/9287a7fef17ab9365f5696f20710cd/gnomad.genomes.r3.0.snv.tsv.gz,/Work/Users/apraga/bisonex/work/13/9287a7fef17ab9365f5696f20710cd/gnomad.genomes.r3.0.indel.tsv.gz  --hgvsg --plugin pLI --plugin LOEUF -o lol
#+end_src
CSQ=G|missense_variant|MODERATE|AGT|ENSG00000135744|Transcript|ENST00000366667|protein_coding|2/5||||843|776|259|M/T|aTg/aCg|||-1||HGNC|HGNC:333||Ensembl||A|A||1:g.230710048A>G|0.347|-0.277922|
Correspond bien à https://www.ensembl.org/Homo_sapiens/Tools/VEP/Results?tl=I7ZsIbrj14P6lD43-
9115494
***** DONE Utiliser whole genome
CLOSED: [2023-04-29 Sat 15:46]
***** KILL Renommer les chromosome avant ...
CLOSED: [2023-05-01 Mon 09:14] SCHEDULED: <2023-04-30 Sun>
Trop long !
- Téléchargement de CADD: 4h20
- renommer les chromosome pour SNV : 6h20
- tabix sur les SNV : job tué au bout de 21h....
***** DONE annoter séparément et fusionner les tableaux
CLOSED: [2023-05-07 Sun 14:45] SCHEDULED: <2023-05-01 Mon>
NB: on pourrait filtrer CADD avec tabix pour se restreindre à nos variants
**** DONE clinvar
CLOSED: [2023-04-22 Sat 15:31]
**** KILL Vérifier résultats HGVS avec mutalyzer
CLOSED: [2023-05-01 Mon 09:26]
**** TODO Parallélisation
***** HOLD par chromosome avec workflow VEP
https://github.com/Ensembl/ensembl-vep/blob/release/109/nextflow/workflows/run_vep.nf
***** HOLD Avec option --fork
**** DONE Utiliser la version de nf-core de VEP
CLOSED: [2023-05-13 Sat 18:27] SCHEDULED: <2023-05-07 Sun>
**** DONE OMIM
CLOSED: [2023-05-08 Mon 15:02] SCHEDULED: <2023-05-01 Mon>
**** TODO Grantham
**** TODO ACMG incidental
**** TODO Gnomad ?
**** TODO ACMG incidental
**** TODO Gnomad ?
**** DONE Filtrer après VEP avec filter_vep
CLOSED: [2023-04-29 Sat 15:47]
nNon testé
*** TODO Comparer les annotations sur 63003856
**** Relancer le nouveau pipeline
*** HOLD Ancienne version
**** TODO HGVS
**** TODO Filtrer après VEP
**** TODO OMIM
**** TODO clinvar
**** TODO ACMG incidental
**** TODO Grantham
**** KILL LRG
CLOSED: [2023-04-18 mar. 17:22] SCHEDULED: <2023-04-18 Tue>
Vu avec alexis, n’est plus à jour
**** TODO Gnomad
** DONE Porter exactement la version d'Alexis sur Helios
CLOSED: [2023-01-14 Sat 17:56]
Branche "prod"
** KILL Tester version d'alexis avec Nix
CLOSED: [2023-06-14 Wed 22:37]
*** DONE Ajouter clinvar
CLOSED: [2022-11-13 Sun 19:37]
*** DONE Alignement
CLOSED: [2022-11-13 Sun 12:52]
*** DONE Haplotype caller
CLOSED: [2022-11-13 Sun 13:00]
*** KILL Filter
CLOSED: [2023-06-14 Wed 22:37]
- [X] depth
- [ ] comon snp not path
Problème avec liste des ID
**** KILL variant annotation
CLOSED: [2023-06-14 Wed 22:37]
Besoin de vep
*** KILL Variant calling
CLOSED: [2023-06-14 Wed 22:37]
** STRT Tester sarek
#+begin_src sh
 module load apptainer/1.1.8
 nextflow run nf-core/sarek -profile test,singularity --outdir test-sarek
#+end_src
Les dépendences ne se téléchargent pas correctement, on les extrait à la main
#+begin_src sh
 rg -IN galaxyproject modules  | sed 's/ //g;s/:$//' | sort | uniq > deps.txt
#+end_src
 Nettoyage à la main
 Puis
 #+begin_src sh
 cat deps.txt | xargs -L1 singularity pull
 #+end_src
* Amélioration :amelioration:
* Documentation
:PROPERTIES:
:CATEGORY: doc
:END:
** DONE Procédure d'installation nix + dependences pour VM CHU
CLOSED: [2023-04-22 Sat 15:27] SCHEDULED: <2023-04-13 Thu>
* Manuscript
:PROPERTIES:
:CATEGORY: manuscript
:END:
* Tests :tests:
** KILL Non régression : version prod
CLOSED: [2023-05-23 Tue 08:46]
*** DONE ID common snp
CLOSED: [2022-11-19 Sat 21:36]
#+begin_src
$ wc -l ID_of_common_snp.txt
23194290 ID_of_common_snp.txt
$ wc -l /Work/Users/apraga/bisonex/database/dbSNP/ID_of_common_snp.txt
23194290 /Work/Users/apraga/bisonex/database/dbSNP/ID_of_common_snp.txt
#+end_src
*** DONE ID common snp not clinvar patho
CLOSED: [2022-12-11 Sun 20:11]
**** DONE Vérification du problème
CLOSED: [2022-12-11 Sun 16:30]
Sur le J:
21155134 /Work/Groups/bisonex/data/dbSNP/GRCh38.p13/ID_of_common_snp_not_clinvar_patho.txt.ref
Version de "non-régression"
21155076 database/dbSNP/ID_of_common_snp_not_clinvar_patho.txt
Nouvelle version
23193391 /Work/Groups/bisonex/data/dbSNP/GRCh38.p13/ID_of_common_snp_not_clinvar_patho.txt
Si on enlève les doublons
$ sort database/dbSNP/ID_of_common_snp_not_clinvar_patho.txt | uniq > old.txt
$ wc -l old.txt
21107097 old.txt
$ sort /Work/Groups/bisonex/data/dbSNP/GRCh38.p13/ID_of_common_snp_not_clinvar_patho.txt | uniq > new.txt
$ wc -l new.txt
21174578 new.txt
$ sort /Work/Groups/bisonex/data/dbSNP/GRCh38.p13/ID_of_common_snp_not_clinvar_patho.txt.ref | uniq > ref.txt
$ wc -l ref.txt
21107155 ref.txt
Si on regarde la différence
 comm -23 ref.txt old.txt
rs1052692
rs1057518973
rs1057518973
rs11074121
rs112848754
rs12573787
rs145033890
rs147889095
rs1553904159
rs1560294695
rs1560296615
rs1560310926
rs1560325547
rs1560342418
rs1560356225
rs1578287542
...
On cherche le premier
bcftools query -i 'ID="rs1052692"' database/dbSNP/dbSNP_common.vcf.gz -f '%CHROM %POS %REF %ALT\n'
NC_000019.10 1619351 C A,T
Il est bien patho...
$ bcftools query -i 'POS=1619351' database/clinvar/clinvar.vcf.gz -f '%CHROM %POS %REF %ALT %INFO/CLNSIG\n'
19 1619351 C T Conflicting_interpretations_of_pathogenicity
On vérifie pour tous les autres
$ comm -23 ref.txt old.txt > tocheck.txt
On génère les régions à vérifier (chromosome number:position)
$ bcftools query -i 'ID=@tocheck.txt' database/dbSNP/dbSNP_common.vcf.gz -f '%CHROM\t%POS\n' > tocheck.pos
On génère le mapping inverse (chromosome number -> NC)
$ awk ' { t = $1; $1 = $2; $2 = t; print; } ' database/RefSeq/refseq_to_number_only_consensual.txt  > mapping.txt
On remap clinvar
$ bcftools annotate --rename-chrs mapping.txt database/clinvar/clinvar.vcf.gz -o clinvar_remapped.vcf.gz
$ tabix clinvar_remapped.vcf.gz
Enfin, on cherche dans clinvar la classification
$ bcftools query -R tocheck.pos clinvar_remapped.vcf.gz -f '%CHROM %POS %INFO/CLNSIG\n'
$ bcftools query -R tocheck.pos database/dbSNP/dbSNP_common.vcf.gz -f '%CHROM %POS %ID \n' | grep '^NC'
#+RESULTS:
**** DONE Comprendre pourquoi la nouvelle version donne un résultat différent
CLOSED: [2022-12-11 Sun 20:11]
***** DONE Même version dbsnp et clinvar ?
CLOSED: [2022-12-10 Sat 23:02]
Clinvar différent !
  $ bcftools stats clinvar.gz
  clinvar (Alexis)
SN	0	number of samples:	0
SN	0	number of records:	1492828
SN	0	number of no-ALTs:	965
SN	0	number of SNPs:	1338007
SN	0	number of MNPs:	5562
SN	0	number of indels:	144580
SN	0	number of others:	3714
SN	0	number of multiallelic sites:	0
SN	0	number of multiallelic SNP sites:	0
clinvar (new)
SN	0	number of samples:	0
SN	0	number of records:	1493470
SN	0	number of no-ALTs:	965
SN	0	number of SNPs:	1338561
SN	0	number of MNPs:	5565
SN	0	number of indels:	144663
SN	0	
number of others:	3716
SN	0	number of multiallelic sites:	0
SN	0	number of multiallelic SNP sites:	0
***** DONE Mettre à jour c
linvar et dbnSNP pour travailler sur les mêm bases
CLOSED: [2022-12-11 Sun 12:10]
Problème persiste
***** DONE Supprimer la conversion en int du chromosome
CLOSED: [2022-12-10 Sat 19:29]
***** KILL Même NC ?
CLOSED: [2022-12-10 Sat 19:29]
$  zgrep "contig=<ID=NC_\(.*\)" clinvar/GRCh38/clinvar.vcf.gz > contig.clinvar
$ diff contig.txt contig.clinvar
< ##contig=<ID=NC_012920.1>
***** DONE Tester sur chromosome 19: ok
CLOSED: [2022-12-11 Sun 13:53]
On prépare les données
#+begin_src sh :dir /ssh:meso:/Work/Users/apraga/bisonex/tests/debug-commonsnp
PATH=$PATH:$HOME/.nix-profile/bin
bcftools filter -i 'CHROM="NC_000019.10"' /Work/Groups/bisonex/data/dbSNP/GRCh38.p13/dbSNP_common.vcf.gz -o dbSNP_common_19.vcf.gz
bcftools filter -i 'CHROM="NC_000019.10"' /Work/Groups/bisonex/data/clinvar/GRCh38/clinvar.vcf.gz -o clinvar_19.vcf.gz
bcftools filter -i 'CHROM="NC_000019.10"' /Work/Groups/bisonex/data-alexis/dbSNP/dbSNP_common.vcf.gz -o dbSNP_common_19_old.vcf.gz
 bcftools filter -i 'CHROM="19"' /Work/Groups/bisonex/data-alexis/clinvar/clinvar.vcf.gz -o clinvar_19_old.vcf.gz
#+end_src
On récupère les 2 versions du script
#+begin_src sh :dir /ssh:meso:/Work/Users/apraga/bisonex/tests/debug-commonsnp
PATH=$PATH:$HOME/.nix-profile/bin
git checkout regression ../../script/pythonScript/clinvar_sbSNP.py
cp ../../script/pythonScript/clinvar_sbSNP.py clinvar_sbSNP_old.py
git checkout HEAD ../../script/pythonScript/clinvar_sbSNP.py
#+end_src
#+RESULTS:
On compare
#+begin_src sh :dir /ssh:meso:/Work/Users/apraga/bisonex/tests/debug-commonsnp
PATH=$PATH:$HOME/.nix-profile/bin
python ../../script/pythonScript

[9.37612]

[11.32623]

-i 'POS=10652589' clinvar_chr20.vcf.gz -o clinvar_mwi.vcf.gz
bcftools index -f dbsnp_mwi.vcf.gz
bcftools index -f clinvar_mwi.vcf.gz
bcftools isec dbsnp_mwi.vcf.gz clinvar_mwi.vcf.gz -n=2
#+end_src
#+RESULTS:
Même en biallélique, ne fonctionne pas.
Chr 20
Avec les fichiers du teste précédent
#+begin_src sh :dir ~/code/bisonex/test_isec
bcftools norm -m -any dbsnp_mwi.vcf.gz -o dbsnp_mwi_norm.vcf.gz
bcftools index dbsnp_mwi_norm.vcf.gz
bcftools isec dbsnp_mwi_norm.vcf.gz clinvar_mwi.vcf.gz -n=2
#+end_src
#+RESULTS:
| NC_000020.11 | 10652589 | G | A | 11 |
| NC_000020.11 | 10652589 | G | C | 11 |
******* TODO Sur dbSNP chr20 non
#+begin_src sh :dir ~/code/bisonex/test_isec
bcftools norm -m -any dbSNP_common_chr20 -o dbSNP_common_chr20_norm.vcf.gz
#+end_src
#+begin_src sh :dir ~/code/bisonex/test_isec
bcftools isec -i 'INFO/CLNSIG="Pathogenic"' dbSNP_common_chr20_norm.vcf.gz clinvar_chr20.vcf.gz -p tmp
#+end_src
#+RESULTS:
***** DONE Essai bedtools intersect
#+begin_src sh
bedtools intersect -a  dbSNP_common.vcf.gz -b clinvar.vcf.gz
#+end_src
$ wc -l intersect.vcf
220206 intersect.vcf
** TODO Dépendences avec Nix
*** DONE GATK
CLOSED: [2022-10-21 Fri 21:59]
*** WAIT BioDBHTS
Contribuer pull request
*** DONE BioExtAlign
CLOSED: [2022-10-22 Sat 00:38]
*** WAIT BioBigFile
Revoir si on peut utliser kent dernière version
Contribuer pull request
*** HOLD rtg-tools
Convertir clinvar NC
*** DONE simuscop
CLOSED: [2022-12-30 Fri 22:31]
*** DONE Spip
CLOSED: [2022-12-04 Sun 12:49]
Pas de pull request
*** DONE R + packages
CLOSED: [2022-11-19 Sat 21:05]
*** TODO hap.py
https://github.com/Illumina/hap.py
**** DONE Version sans rtgtools avec python 3
CLOSED: [2023-02-02 Thu 22:15]
Procédure pour tester
#+begin_src
nix develop .#hap-py
$ genericBuild
#+end_src
1. Supprimer l’appel à make_dependencies dans cmakelist.txt : on peut tout installer avec nix
2. Patch Roc.cpp pour avoir numeric_limits ( error: 'numeric_limits' is not a member of 'std')
3. ajout de flags de link (essai, error)
set(ZLIB_LIBRARIES -lz -lbz2 -lcurl -lcrypto -llzma)
4. Changer les appels à print en print() dans le code python et suppression de quelques import
[nix-shell:~/source]$ sed -i.orig 's/print \"\(.*\)"/print(\1)/' src/python/*.py
**** DONE Sérialiser json pour écrire données de sorties
CLOSED: [2023-02-17 Fri 19:25]
**** DONE Tester sur example
CLOSED: [2023-02-04 Sat 00:25]
#+begin_src sh
$ cd hap.py
$ ../result/bin/hap.py example/happy/PG_NA12878_chr21.vcf.gz       example/happy/NA12878_chr21.vcf.gz       -f example/happy/PG_Conf_chr21.bed.gz       -o test -r example/chr21.fa
#+end_src
#+RESULTS:
| Type  | Filter | TRUTH.TOTAL | TRUTH.TP | TRUTH.FN | QUERY.TOTAL | QUERY.FP | QUERY.UNK | FP.gt | FP.al | METRIC.Recall | METRIC.Precision | METRIC.Frac_NA | METRIC.F1_Score |
| INDEL | ALL    |        8937 |     7839 |     1098 |       11812 |      343 |      3520 |    45 |   283 |      0.877140 |         0.958635 |       0.298002 |        0.916079 |
| INDEL | PASS   |        8937 |     7550 |     1387 |        9971 |      283 |      1964 |    30 |   242 |      0.844803 |         0.964656 |       0.196971 |        0.900760 |
| SNP   | ALL    |       52494 |    52125 |      369 |       90092 |      582 |     37348 |   107 |   354 |      0.992971 |         0.988966 |       0.414554 |        0.990964 |
| SNP   | PASS   |       52494 |    46920 |     5574 |       48078 |      143 |       992 |     8 |    97 |      0.893816 |         0.996963 |       0.020633 |        0.942576 |
**** KILL Version avec rtg-tools
CLOSED: [2023-07-30 Sun 14:38]
**** HOLD Faire fonctionner Tests
***** HOLD Essai 2 : depuis nix develop:
#+begin_src
nix develop .#hap-py
genericBuild
#+end_src
Lancé initialement à la main, mais on peut maintenant utiliser run_tests
#+begin_src
HCDIR=bin/ ../src/sh/run_tests.sha
#+end_src
- [X] test boost
- [X] multimerge
- [X] hapenum
- [X] fp accuracy
- [X] faulty variant
- leftshift fails
- [X] other vcf
- [X] chr prefix
- [X] gvcf
- [X] decomp
- [X] contig lengt
- [X]  integration test
- [ ] scmp fails sur le type
- [X] giab
- [X] performance
- [ ] quantify fails sur le type
- [ ] stratified échec sur les résultats !
- [X] pg counting
- [ ] sompy: ne trouve pas Strelka dans somatic
phases="buildPhase checkPhase installPhase fixupPhase" genericBuild
#+end_src
**** KILL Reproduire les performances precisionchallenge : attention à HG002 et HG001!
CLOSED: [2023-04-01 Sat 19:43]
https://www.nist.gov/programs-projects/genome-bottle
***** KILL 0GOOR
CLOSED: [2023-04-01 Sat 19:40]
Le problème venait 1. de l'ADN et 2. du renommage des chromosomes qui était faux
****** DONE HG002
CLOSED: [2023-02-17 Fri 19:31]
 Type Filter  TRUTH.TOTAL  TRUTH.TP  TRUTH.FN  QUERY.TOTAL  QUERY.FP  QUERY.UNK  FP.gt  FP.al  METRIC.Recall  METRIC.Precision  METRIC.Frac_NA  METRIC.F1_Score
INDEL    ALL       525466    491355     34111      1156702     57724     605307   9384  25027       0.935084          0.895313        0.523304         0.914766
INDEL   PASS       525466    491355     34111      1156702     57724     605307   9384  25027       0.935084          0.895313        0.523304         0.914766
  SNP    ALL      3365115   3358399      6716      5666020     21995    2284364   4194   1125       0.998004          0.993496        0.403169         0.995745
  SNP   PASS      3365115   3358399      6716      5666020     21995    2284364   4194   1125       0.998004          0.993496        0.403169         0.995745
 TRUTH.TOTAL.TiTv_ratio  QUERY.TOTAL.TiTv_ratio  TRUTH.TOTAL.het_hom_ratio  QUERY.TOTAL.het_hom_ratio
                    NaN                     NaN                   1.528276                   2.752637
                    NaN                     NaN                   1.528276                   2.752637
               2.100129                1.473519                   1.581196                   1.795603
               2.100129                1.473519                   1.581196                   1.795603
***** KILL Avec python2
CLOSED: [2023-02-17 Fri 19:25]
****** KILL avec nix
CLOSED: [2023-02-17 Fri 19:25]
conda create -n python2 python=2.7 anaconda
****** KILL avec conda
CLOSED: [2023-02-17 Fri 19:25]
******* Gentoo: regex_error sur test...
Ok avec bash !
#+begin_src
anaconda3/bin/conda create --name py2 python=2.7
conda activate py2
conda install -c bioconda hap.py
#+end_src
******** Faire tourner les tests.
Il faut remplace bin/test_haplotypes par test_haplotypes dans src/sh/run_tests.sh
#+begin_src sh
 HGREF=../genome/GRCh38/GCA_000001405.15_GRCh38_no_alt_analysis_set.fasta HCDIR=~/anaconda3/envs/py2/bin bash src/sh/run_tests.sh
#+end_src
Echec:
test_haplotypes: /opt/conda/conda-bld/work/hap.py-0.3.7/src/c++/lib/tools/Fasta.cpp:81: MMappedFastaFile::MMappedFastaFile(const string&): Assertion `fd != -1' failed.
unknown location(0): fatal error in "testVariantPrimitiveSplitter": signal: SIGABRT (application abort requested)
/opt/conda/conda-bld/work/hap.py-0.3.7/src/c++/test/test_align.cpp(298): last checkpoint
******** Chr21
HGREF=../genome/GRCh38/GCA_000001405.15_GRCh38_no_alt_analysis_set.fasta hap.py        example/happy/PG_NA12878_chr21.vcf.gz       example/happy/NA12878_chr21.vcf.gz       -f example/happy/PG_Conf_chr21.bed.gz       -o test
******* Helios
échec
** TODO T2T :T2T:
Toutes les ressourcs sont décrites ici
https://github.com/marbl/CHM13
Détails sur le pipeline
https://genome.ucsc.edu/cgi-bin/hgTrackUi?db=hub_3267197_GCA_009914755.4&c=CP068277.2&g=hub_3267197_hgLiftOver
*** Liftover pipelines
:PROPERTIES:
:ID:       d2280207-3f65-4a31-a291-41fa9a9658c2
:END:
Contient les chain files
*** DONE Alignement
CLOSED: [2023-06-26 Mon 19:42]
NXF_OPTS=-D"user.name=${USER}" nextflow run main.nf -profile standard,helios  --input="/Work/Groups/bisonex/data/giab/*_R{1,2}_001.fastq.gz" --id=NA12878-T2T -bg
SCHEDULED: <2023-06-14 Wed>
*** DONE Haplotypecaller
CLOSED: [2023-06-26 Mon 19:42] SCHEDULED: <2023-06-15 Thu>
*** DONE Faire fonctionner le filtre technical variant
CLOSED: [2023-08-03 Thu 14:24] SCHEDULED: <2023-08-03 Wed 10:30>
*** TODO Générer la base de donnée spip
SCHEDULED: <2023-08-03 Thu 11:30>
*** PROJ Porter Spip
** PROJ Indicateurs qualité
*** Idée
Raredisease:
- FastQC : nombreuses statistiques. Non disponible Nix
- Mosdepth : calcule la profondeur (2x plus rapide que samtools depth). Nix
- MultiQC : fusionne juste les résultats des analyses. Non disponible nix
- Picard's CollectMutipleMetrics, CollectHsMetrics, and CollectWgsMetrics
- Qualimap : alternative fastqc ? Non disponible nix
- Sentieon's WgsMetricsAlgo : propriétaire
- TIDDIT's cov : TIDIT = remaninement chromosomique
Sarek:
- alignment statistics : samtools stats, mosdepth
- QC : MultiQC
MultiQC : non disponible Nix
** PROJ vérifier si normalisation
** PROJ Rajouter vérification hgvs
** DONE Exécution
CLOSED: [2022-09-13 Tue 21:37]
*** KILL test Bionix
*** KILL Implémenter execution avec Nix ?
Voir https://academic.oup.com/gigascience/article/9/11/giaa121/5987272?login=false
pour un exemple.
Probablement plus simple d’utiliser Nix pour gestion de l’environnement et snakemake pour l’exécution
Pas d’accès internet depuis le cluster
*** DONE nextflow
CLOSED: [2022-09-13 Tue 21:37]
**** TODO Bug scheduler SGE
Le job se fait tuer car l'utilisateur n'est pas passé correctement à nextflow
***** DONE Forcer l'utilisateur à l'exécution
CLOSED: [2023-04-01 Sat 17:57]
NXF_OPTS=-D"user.name=alex"
***** DONE Vérifier si le problème persiste avec 22.10.6
CLOSED: [2023-04-01 Sat 18:38] SCHEDULED: <2023-04-01 Sat>
oui
***** KILL Packager l'utilisateur dans le programme ?
Mauvaise idée..
** TODO Preprocessing avec nextflow
*** TODO Map to reference
**** TODO Sample ID dans header
/Work/Users/apraga/bisonex/out/63003856_S135/preprocessing/baserecalibrator
*** DONE Mark duplicate
CLOSED: [2022-10-09 Sun 22:30]
*** DONE Recalibrate base quality score
CLOSED: [2022-10-09 Sun 22:30]
** DONE Variant calling avec Nextflow
CLOSED: [2022-11-19 Sat 21:34]
*** DONE Haplotype caller
CLOSED: [2022-10-09 Sun 22:40]
*** DONE Filter variants
CLOSED: [2022-10-09 Sun 22:40]
*** DONE Filter common snp not clinvar path
CLOSED: [2022-11-07 Mon 23:00]
Voir [[*common dbSNP not clinvar patho][common dbSNP not clinvar patho]]
*** DONE Filter variant only in consensual sequence
CLOSED: [2022-11-08 Tue 22:23]
*** DONE Filter technical variants
CLOSED: [2022-11-19 Sat 21:34]
*** DONE Utilise AVX pour accélerer l'exécution
CLOSED: [2023-04-29 Sat 15:46]
Sans cela, on a l'avertissement
#+begin_quote
17:28:00.720 INFO  PairHMM - OpenMP multi-threaded AVX-accelerated native PairHMM implementation is not supported
17:28:00.721 INFO  NativeLibraryLoader - Loading libgkl_utils.so from jar:file:/nix/store/cy9ckxqwrkifx7wf02hm4ww1p6lnbxg9-gatk-4.2.4.1/bin/gatk-package-4.2.4.1-local.jar!/com/intel/gkl/native/libgkl_utils.so
17:28:00.733 WARN  NativeLibraryLoader - Unable to load libgkl_utils.so from native/libgkl_utils.so (/Work/Users/apraga/bisonex/out/NA12878_NIST7035/preprocessing/applybqsr/libgkl_utils821485189051585397.so: libgomp.so.1: cannot open shared object file: No such file or directory)
17:28:00.733 WARN  IntelPairHmm - Intel GKL Utils not loaded
17:28:00.733 WARN  PairHMM - ***WARNING: Machine does not have the AVX instruction set support needed for the accelerated AVX PairHmm. Falling back to the MUCH slower LOGLESS_CACHING implementation!
17:28:00.763 INFO  ProgressMeter - Starting traversal
#+end_quote
libgomp.so est fourni par gcc donc il faut charger le module
 module load gcc@11.3.0/gcc-12.1.0
** KILL Utiliser subworkflow
CLOSED: [2023-04-02 Sun 18:08]
Notre version permet d'être plus souple
*** KILL Alignement
CLOSED: [2023-04-02 Sun 18:08] SCHEDULED: <2023-04-05 Wed>
*** KILL Vep
CLOSED: [2023-04-02 Sun 18:08] SCHEDULED: <2023-04-05 Wed>
vcf_annotate_ensemblvep
** TODO Annotation avec nextflow :annotation:
*** KILL VEP : --gene-phenotype ?
CLOSED: [2023-04-18 mar. 18:32]
Vu avec alexis : bases de données non à jour
https://www.ensembl.org/info/genome/variation/phenotype/sources_phenotype_documentation.html
*** DONE plugin VEP
CLOSED: [2023-04-18 mar. 18:32]
Cloner dépôt git avec plugin
Puis utiliser --dir_plugins
*** HOLD Utiliser code d’Alexis
*** TODO Nouvelle version avec VEP
Example avec --custom
https://www.ensembl.org/info/docs/tools/vep/script/vep_custom.html
**** DONE Ajout spliceAI
CLOSED: [2023-05-18 Thu 11:02] SCHEDULED: <2023-04-30 Sun>
plugin VEP
***** DONE Télécharger les données
CLOSED: [2023-05-11 Thu 19:01]
Difficile d'automatiser, le lien est temporaire...
***** DONE PLugin
CLOSED: [2023-05-11 Thu 20:16]
***** DONE Séparer score en plusieurs colonnes
CLOSED: [2023-05-11 Thu 20:16]
Test avec ce fichier pour avoir une ligne avec annotation et une ligne sans
#CHROM	POS	ID	REF	ALT
1	9091	.	A	C
1	69091	.	A	C
et
#+begin_src sh
rm -f postvep.tsv* && vep -i testspliceai.vcf.gz -o postvep.tsv --tab  --dir 109 --merged --pick --use_given_ref   --offline  --plugin SpliceAI,snv=spliceai_scores.raw.snv.hg38.vcf.gz,indel=spliceai_scores.raw.indel.hg38.vcf.gz
#+end_src
#+begin_src
$ bgzip postvep.tsv
$ python spliceai.py
$ cat postvep2.tsv
,variation,Location,Allele,Gene,Feature,Feature_type,Consequence,cDNA_position,CDS_position,Protein_position,Amino_acids,Codons,Existing_variation,IMPACT,DISTANCE,STRAND,FLAGS,REFSEQ_MATCH,SOURCE,REFSEQ_OFFSET,SpliceAI_AG,SpliceAI_AL,SpliceAI_DG,SpliceAI_DL
0,1_9091_A/C,1:9091,C,ENSG00000290825,ENST00000456328,Transcript,upstream_gene_variant,-,-,-,-,-,-,MODIFIER,2778,1,-,-,Ensembl,-,,,,
1,1_69091_A/C,1:69091,C,ENSG00000186092,ENST00000641515,Transcript,missense_variant,124,64,22,M/L,Atg/Ctg,-,MODERATE,-,1,-,-,Ensembl,-,0.01,0.00,0.00,0.01
#+end_src
Test
cp work/bf/437ae511958509e43072f032f4d495/small.tab.gz tests/vep-spip.tab.gz
cp work/d5/3b1244b5ae83d54409ee0d456e8c55/small_cadd.tab.gz tests/vep-cadd-splice.tab.gz
**** TODO Package Nix spliceAI ?
nix profile install nixpkgs#python3Packages.tensorflow
+ ajouter dépendencs ("grep import" ou cnad)
**** TODO Ajout LOEUF et pli
plugin VEP
**** TODO NMD
**** KILL Ajout LOEUF
CLOSED: [2023-04-19 mer. 16:32]
plugin VEP
**** DONE Spip
CLOSED: [2023-05-01 Mon 23:07] SCHEDULED: <2023-04-30 Sun>
BED ne semble pas bien marcher (il faut définir une zone)
VCF : trop d’information
Attention, plusieurs transcripts mais résultats identiques. On supprimer les doublons
***** DONE interpretation + score + intervalle de confiance séparé
CLOSED: [2023-05-01 Mon 23:07] SCHEDULED: <2023-04-30 Sun>
Tests :
dans tests/
vep -i 63004925-small.vcf -o postvep.vcf --vcf --fasta genomeRef.fna --dir 109 --merged --pick  --offline --custom ../script/spip_annotation.vcf.gz,SPIP,vcf,exact,0,spipInterp,spipScore,spipConfidence
***** DONE Score
CLOSED: [2023-04-22 Sat 15:30]
**** DONE CADD: remplacer par plugin VEP
CLOSED: [2023-05-07 Sun 14:45] SCHEDULED: <2023-05-07 Sun>
***** Test
#+begin_src
vep  -i test.vcf  -o lol.vcf --offline --dir  /Work/Projects/bisonex/data/vep/GRCh38/ --merged --vcf --fasta /Work/Projects/bisonex/data/genome/GRCh38.p13/genomeRef.fna --plugin CADD,/Work/Users/apraga/bisonex/work/13/9287a7fef17ab9365f5696f20710cd/gnomad.genomes.r3.0.snv.tsv.gz,/Work/Users/apraga/bisonex/work/13/9287a7fef17ab9365f5696f20710cd/gnomad.genomes.r3.0.indel.tsv.gz  --dir_plugins ../VEP_plugins/ -v
#+end_src
Test
#+begin_src sh
vep --id "1  230710048 230710048 A/G 1"   --offline --dir  /Work/Projects/bisonex/data/vep/GRCh38/ --merged --vcf --fasta /Work/Projects/bisonex/data/genome/GRCh38.p13/genomeRef.fna --plugin CADD,/Work/Users/apraga/bisonex/work/13/9287a7fef17ab9365f5696f20710cd/gnomad.genomes.r3.0.snv.tsv.gz,/Work/Users/apraga/bisonex/work/13/9287a7fef17ab9365f5696f20710cd/gnomad.genomes.r3.0.indel.tsv.gz  --hgvsg --plugin pLI --plugin LOEUF -o lol
#+end_src
CSQ=G|missense_variant|MODERATE|AGT|ENSG00000135744|Transcript|ENST00000366667|protein_coding|2/5||||843|776|259|M/T|aTg/aCg|||-1||HGNC|HGNC:333||Ensembl||A|A||1:g.230710048A>G|0.347|-0.277922|
Correspond bien à https://www.ensembl.org/Homo_sapiens/Tools/VEP/Results?tl=I7ZsIbrj14P6lD43-9115494
***** DONE Utiliser whole genome
CLOSED: [2023-04-29 Sat 15:46]
***** KILL Renommer les chromosome avant ...
CLOSED: [2023-05-01 Mon 09:14] SCHEDULED: <2023-04-30 Sun>
Trop long !
- Téléchargement de CADD: 4h20
- renommer les chromosome pour SNV : 6h20
- tabix sur les SNV : job tué au bout de 21h....
***** DONE annoter séparément et fusionner les tableaux
CLOSED: [2023-05-07 Sun 14:45] SCHEDULED: <2023-05-01 Mon>
NB: on pourrait filtrer CADD avec tabix pour se restreindre à nos variants
**** DONE clinvar
CLOSED: [2023-04-22 Sat 15:31]
**** KILL Vérifier résultats HGVS avec mutalyzer
CLOSED: [2023-05-01 Mon 09:26]
**** TODO Parallélisation
***** HOLD par chromosome avec workflow VEP
https://github.com/Ensembl/ensembl-vep/blob/release/109/nextflow/workflows/run_vep.nf
***** HOLD Avec option --fork
**** DONE Utiliser la version de nf-core de VEP
CLOSED: [2023-05-13 Sat 18:27] SCHEDULED: <2023-05-07 Sun>
**** DONE OMIM
CLOSED: [2023-05-08 Mon 15:02] SCHEDULED: <2023-05-01 Mon>
**** TODO Grantham
**** TODO ACMG incidental
**** TODO Gnomad ?
**** TODO ACMG incidental
**** TODO Gnomad ?
**** DONE Filtrer après VEP avec filter_vep
CLOSED: [2023-04-29 Sat 15:47]
nNon testé
*** TODO Comparer les annotations sur 63003856
**** Relancer le nouveau pipeline
*** HOLD Ancienne version
**** TODO HGVS
**** TODO Filtrer après VEP
**** TODO OMIM
**** TODO clinvar
**** TODO ACMG incidental
**** TODO Grantham
**** KILL LRG
CLOSED: [2023-04-18 mar. 17:22] SCHEDULED: <2023-04-18 Tue>
Vu avec alexis, n’est plus à jour
**** TODO Gnomad
** DONE Porter exactement la version d'Alexis sur Helios
CLOSED: [2023-01-14 Sat 17:56]
Branche "prod"
** KILL Tester version d'alexis avec Nix
CLOSED: [2023-06-14 Wed 22:37]
*** DONE Ajouter clinvar
CLOSED: [2022-11-13 Sun 19:37]
*** DONE Alignement
CLOSED: [2022-11-13 Sun 12:52]
*** DONE Haplotype caller
CLOSED: [2022-11-13 Sun 13:00]
*** KILL Filter
CLOSED: [2023-06-14 Wed 22:37]
- [X] depth
- [ ] comon snp not path
Problème avec liste des ID
**** KILL variant annotation
CLOSED: [2023-06-14 Wed 22:37]
Besoin de vep
*** KILL Variant calling
CLOSED: [2023-06-14 Wed 22:37]
** STRT Tester sarek
#+begin_src sh
 module load apptainer/1.1.8
 nextflow run nf-core/sarek -profile test,singularity --outdir test-sarek
#+end_src
Les dépendences ne se téléchargent pas correctement, on les extrait à la main
#+begin_src sh
 rg -IN galaxyproject modules  | sed 's/ //g;s/:$//' | sort | uniq > deps.txt
#+end_src
 Nettoyage à la main
 Puis
 #+begin_src sh
 cat deps.txt | xargs -L1 singularity pull
 #+end_src
** DONE Support pour samplesheet
CLOSED: [2023-08-03 Thu 14:24] SCHEDULED: <2023-08-03 Thu 13:00>
/Entered on/ [2023-08-03 Thu 13:12]
* Amélioration :amelioration:
* Documentation
:PROPERTIES:
:CATEGORY: doc
:END:
** DONE Procédure d'installation nix + dependences pour VM CHU
CLOSED: [2023-04-22 Sat 15:27] SCHEDULED: <2023-04-13 Thu>
* Manuscript
:PROPERTIES:
:CATEGORY: manuscript
:END:
* Tests :tests:
** KILL Non régression : version prod
CLOSED: [2023-05-23 Tue 08:46]
*** DONE ID common snp
CLOSED: [2022-11-19 Sat 21:36]
#+begin_src
$ wc -l ID_of_common_snp.txt
23194290 ID_of_common_snp.txt
$ wc -l /Work/Users/apraga/bisonex/database/dbSNP/ID_of_common_snp.txt
23194290 /Work/Users/apraga/bisonex/database/dbSNP/ID_of_common_snp.txt
#+end_src
*** DONE ID common snp not clinvar patho
CLOSED: [2022-12-11 Sun 20:11]
**** DONE Vérification du problème
CLOSED: [2022-12-11 Sun 16:30]
Sur le J:
21155134 /Work/Groups/bisonex/data/dbSNP/GRCh38.p13/ID_of_common_snp_not_clinvar_patho.txt.ref
Version de "non-régression"
21155076 database/dbSNP/ID_of_common_snp_not_clinvar_patho.txt
Nouvelle version
23193391 /Work/Groups/bisonex/data/dbSNP/GRCh38.p13/ID_of_common_snp_not_clinvar_patho.txt
Si on enlève les doublons
$ sort database/dbSNP/ID_of_common_snp_not_clinvar_patho.txt | uniq > old.txt
$ wc -l old.txt
21107097 old.txt
$ sort /Work/Groups/bisonex/data/dbSNP/GRCh38.p13/ID_of_common_snp_not_clinvar_patho.txt | uniq > new.txt
$ wc -l new.txt
21174578 new.txt
$ sort /Work/Groups/bisonex/data/dbSNP/GRCh38.p13/ID_of_common_snp_not_clinvar_patho.txt.ref | uniq > ref.txt
$ wc -l ref.txt
21107155 ref.txt
Si on regarde la différence
 comm -23 ref.txt old.txt
rs1052692
rs1057518973
rs1057518973
rs11074121
rs112848754
rs12573787
rs145033890
rs147889095
rs1553904159
rs1560294695
rs1560296615
rs1560310926
rs1560325547
rs1560342418
rs1560356225
rs1578287542
...
On cherche le premier
bcftools query -i 'ID="rs1052692"' database/dbSNP/dbSNP_common.vcf.gz -f '%CHROM %POS %REF %ALT\n'
NC_000019.10 1619351 C A,T
Il est bien patho...
$ bcftools query -i 'POS=1619351' database/clinvar/clinvar.vcf.gz -f '%CHROM %POS %REF %ALT %INFO/CLNSIG\n'
19 1619351 C T Conflicting_interpretations_of_pathogenicity
On vérifie pour tous les autres
$ comm -23 ref.txt old.txt > tocheck.txt
On génère les régions à vérifier (chromosome number:position)
$ bcftools query -i 'ID=@tocheck.txt' database/dbSNP/dbSNP_common.vcf.gz -f '%CHROM\t%POS\n' > tocheck.pos
On génère le mapping inverse (chromosome number -> NC)
$ awk ' { t = $1; $1 = $2; $2 = t; print; } ' database/RefSeq/refseq_to_number_only_consensual.txt  > mapping.txt
On remap clinvar
$ bcftools annotate --rename-chrs mapping.txt database/clinvar/clinvar.vcf.gz -o clinvar_remapped.vcf.gz
$ tabix clinvar_remapped.vcf.gz
Enfin, on cherche dans clinvar la classification
$ bcftools query -R tocheck.pos clinvar_remapped.vcf.gz -f '%CHROM %POS %INFO/CLNSIG\n'
$ bcftools query -R tocheck.pos database/dbSNP/dbSNP_common.vcf.gz -f '%CHROM %POS %ID \n' | grep '^NC'
#+RESULTS:
**** DONE Comprendre pourquoi la nouvelle version donne un résultat différent
CLOSED: [2022-12-11 Sun 20:11]
***** DONE Même version dbsnp et clinvar ?
CLOSED: [2022-12-10 Sat 23:02]
Clinvar différent !
  $ bcftools stats clinvar.gz
  clinvar (Alexis)
SN	0	number of samples:	0
SN	0	number of records:	1492828
SN	0	number of no-ALTs:	965
SN	0	number of SNPs:	1338007
SN	0	number of MNPs:	5562
SN	0	number of indels:	144580
SN	0	number of others:	3714
SN	0	number of multiallelic sites:	0
SN	0	number of multiallelic SNP sites:	0
clinvar (new)
SN	0	number of samples:	0
SN	0	number of records:	1493470
SN	0	number of no-ALTs:	965
SN	0	number of SNPs:	1338561
SN	0	number of MNPs:	5565
SN	0	number of indels:	144663
SN	0	number of others:	3716
SN	0	number of multiallelic sites:	0
SN	0	number of multiallelic SNP sites:	0
***** DONE Mettre à jour clinvar et dbnSNP pour travailler sur les mêm bases
CLOSED: [2022-12-11 Sun 12:10]
Problème persiste
***** DONE Supprimer la conversion en int du chromosome
CLOSED: [2022-12-10 Sat 19:29]
***** KILL Même NC ?
CLOSED: [2022-12-10 Sat 19:29]
$  zgrep "contig=<ID=NC_\(.*\)" clinvar/GRCh38/clinvar.vcf.gz > contig.clinvar
$ diff contig.txt contig.clinvar
< ##contig=<ID=NC_012920.1>
***** DONE Tester sur chromosome 19: ok
CLOSED: [2022-12-11 Sun 13:53]
On prépare les données
#+begin_src sh :dir /ssh:meso:/Work/Users/apraga/bisonex/tests/debug-commonsnp
PATH=$PATH:$HOME/.nix-profile/bin
bcftools filter -i 'CHROM="NC_000019.10"' /Work/Groups/bisonex/data/dbSNP/GRCh38.p13/dbSNP_common.vcf.gz -o dbSNP_common_19.vcf.gz
bcftools filter -i 'CHROM="NC_000019.10"' /Work/Groups/bisonex/data/clinvar/GRCh38/clinvar.vcf.gz -o clinvar_19.vcf.gz
bcftools filter -i 'CHROM="NC_000019.10"' /Work/Groups/bisonex/data-alexis/dbSNP/dbSNP_common.vcf.gz -o dbSNP_common_19_old.vcf.gz
 bcftools filter -i 'CHROM="19"' /Work/Groups/bisonex/data-alexis/clinvar/clinvar.vcf.gz -o clinvar_19_old.vcf.gz
#+end_src
On récupère les 2 versions du script
#+begin_src sh :dir /ssh:meso:/Work/Users/apraga/bisonex/tests/debug-commonsnp
PATH=$PATH:$HOME/.nix-profile/bin
git checkout regression ../../script/pythonScript/clinvar_sbSNP.py
cp ../../script/pythonScript/clinvar_sbSNP.py clinvar_sbSNP_old.py
git checkout HEAD ../../script/pythonScript/clinvar_sbSNP.py
#+end_src
#+RESULTS:
On compare
#+begin_src sh :dir /ssh:meso:/Work/Users/apraga/bisonex/tests/debug-commonsnp
PATH=$PATH:$HOME/.nix-profile/bin
python ../../script/pythonScript

Replacement in projects/bisonex.org at line 41 [8.35]

B:BD[10.16869] → [5.29:16413]

  64 |       340 |     8 |    17 |      0.890710 |         0.885510 |
| SNP   |       21973 |    21462 |      511 |       26285 |      563 |      4263 |    68 |    16 |      0.976744 |         0.974435 |
****** DONE Interesection des bed: similaire
CLOSED: [2023-07-04 Tue 23:11]
HG38
 #+begin_src sh
 bedtools intersect -a capture/Agilent_SureSelect_All_Exons_v7_hg38_Regions.bed -b /Work/Groups/bisonex/data/giab/GRCh38/HG001_GRCh38_1_22_v4.2.1_benchmark.bed  | wc -l
 #+end_src
 204280
 T2T
 #+begin_src sh
 bedtools intersect -a /Work/Groups/bisonex/data/giab/T2T/Agilent_SureSelect_All_Exons_v7_hg38_Regions_hg38_T2T.bed -b /Work/Groups/bisonex/data/giab/T2T/HG001_GRCh38_1_22_v4.2.1_benchmark_hg38_T2T.bed  | wc -l
 #+end_src
 204021
****** DONE Vérifier la ligne de commande
CLOSED: [2023-07-04 Tue 23:38]
#+begin_src sh
hap.py \
    HG001_GRCh38_1_22_v4_lifted_merged.vcf.gz \
    HG001-SRX11061486_SRR14724513-T2T.vcf.gz \
     \
    --reference chm13v2.0.fa \
    --threads 6 \
     \
    -T Agilent_SureSelect_All_Exons_v7_hg38_Regions_hg38_T2T.bed \
    --false-positives HG001_GRCh38_1_22_v4.2.1_benchmark_hg38_T2T.bed \
     \
    -o HG001
#+end_src
****** DONE Corriger FILTER : mieux mais toujours trop de négatifs. 3/4 SNP retrouvés
CLOSED: [2023-07-08 Sat 15:19] SCHEDULED: <2023-07-08 Sat>
 Type Filter  TRUTH.TOTAL  TRUTH.TP  TRUTH.FN  QUERY.TOTAL  QUERY.FP  QUERY.UNK  FP.gt  FP.al  METRIC.Recall  METRIC.Precision  METRIC.Frac_NA  METRIC.F1_Score  TRUTH.TOTAL.TiTv_ratio  QUERY.TOTAL.TiTv_ratio  TRUTH.TOTAL.het_hom_ratio  QUERY.TOTAL.het_hom_ratio
INDEL    ALL          413       246       167          751       289        215      2     98       0.595642          0.460821        0.286285         0.519629                     NaN                     NaN                   2.428571                   2.465116
INDEL   PASS          413       246       167          751       289        215      2     98       0.595642          0.460821        0.286285         0.519629                     NaN                     NaN                   2.428571                   2.465116
  SNP    ALL        15883     15479       404        23597      5277       2841     46     44       0.974564          0.745760        0.120397         0.844947                3.017198                 2.85705                   5.560099                   2.114633
  SNP   PASS        15883     15479       404        23597      5277       2841     46     44       0.974564          0.745760        0.120397         0.844947                3.017198                 2.85705                   5.560099                   2.114633
******* DONE Vérifier qu'il ne reste plus de filtre autre que PASS
CLOSED: [2023-07-08 Sat 15:19]
#+begin_src
$ zgrep -c 'PASS' HG001_GRCh38_1_22_v4_lifted_merged.vcf.gz
3730505
$ zgrep -c '^chr' HG001_GRCh38_1_22_v4_lifted_merged.vcf.gz
3730506
#+end_src
****** TODO 1/4 SNP manquant ?
******* DONE Regarder avec Julia si ce sont vraiment des FP: 61/5277 qui ne le sont pas
CLOSED: [2023-07-09 Sun 12:09]
******* DONE Examiner les FP
CLOSED: [2023-07-30 Sun 22:05]
******* DONE Tester un FP
CLOSED: [2023-07-30 Sun 22:05]
  2 │ chr1        608765  A           G           ./.:.:.:.:NOCALL:nocall:.  1/1:FP:.:ti:SNP:homalt:188
  liftDown UCSC: rien en GIAB : vrai FP
 3 │ chr1        762943  A           G           ./.:.:.:.:NOCALL:nocall:.  1/1:FP:.:ti:SNP:homalt:287
 4 │ chr1        762945  A           T           ./.:.:.:.:NOCALL:nocall:.  1/1:FP:.:tv:SNP:homalt:287
 Remaniements complexes ? Pas dans le gène en HG38
******* DONE La plupart des FP (4705/5566) sont homozygotes: erreur de référence ?
CLOSED: [2023-07-12 Wed 21:10] SCHEDULED: <2023-07-09 Sun>
Sur les 2 premiers variants, ils montrent en fait la différence entre T2T et GRCh38
Erreur à l'alignement ?
******** KILL relancer l'alignement
CLOSED: [2023-07-09 Sun 17:36]
******** DONE vérifier reads identiques hg38 et T2T: oui
CLOSED: [2023-07-09 Sun 16:36]
T2T CHR1608765
38   	chr1:1180168-1180168 (
SRR14724513.24448214
SRR14724513.24448214
******* TODO Enlever les FP qui correspondent à un changement dans le génome
******** Condition:
- pas de variation à la position en GRCh38
- variantion homozygote
- la varation en T2T correspond au changement de pair de base GRC38 -> T2T
  pour les SNP:
  alt_T2T[i] = DNA_GRC38[j]
  avec i la position en T2T et j la position en GRCh38
  Note: définir un ID n'est pas correct car les variants peuvent être modifié par happy !
******** Idée
 - Pour chaque FP, c'est un "faux" FP si
     - REF en hg38 == ALT en T2T
     - et REF en hg38 != REF en T2T
     - et variant homozygote
Comment obtenir les séquences de réferences ?
1. liftover
2. blat sur la séquence autour du variant
3. identifier quelques reads contenant le variant et regarder leur aligneement en hg38
Après discussion avec Alexis: solution 3
******** Algorithme
1. Extraire les coordonnées en T2T des faux positifs *homozygote*
2. Pour chaque faux positif
   1. lister 10 reads contenant le variant
   2. pour chacun de ces reads, récupérer la séquence en T2T et GRCh38 via le nom du read dans le bam
   3. si la séquence en T2T modifiée par le variant est "identique" à celle en GRCh38, alors on ignore ce faux positif
Note: on ignore les reads qui ont changé de chromosome entre les version
******** DONE Résultat préliminaire
CLOSED: [2023-07-23 Sun 14:30]
cf [[file:~/roam/research/bisonex/code/giab/giab-corrected.csv][script julia]]
3498 faux positifs en moins, soit 0.89 sensibilité
julia> tp=15479
julia> fp=5277
julia> tp/(tp+fp)
0.7457602620928888
julia> tp/(tp+(fp-3498))
0.8969173716537258
On est toujours en dessous des 97%
******** PROJ Corriger proprement VCF ou résultats Happy
******* DONE Vérifier quelques variants sur IGV
CLOSED: [2023-07-09 Sun 17:36]
******* KILL Répartition des FP : cluster ?
CLOSED: [2023-07-09 Sun 17:36]
******* PROJ Examiner les FP restant après correction selon séquence de référence
SCHEDULED: <2023-07-31 Mon>
******* PROJ Examiner les variants supprimé
****** KILL Méthodologie du pangenome
CLOSED: [2023-07-31 Mon 22:29] SCHEDULED: <2023-07-30 Sun>
***** KILL Mail Yannis
CLOSED: [2023-07-08 Sat 10:44]
***** DONE Mail GIAB pour version T2T
CLOSED: [2023-07-07 Fri 18:37]
**** TODO HG002 :hg002:T2T:
**** TODO HG003 :hg003:T2T:
**** TODO HG004 :hg004:T2T:
**** DONE Plot : ashkenazim trio :hg38:
CLOSED: [2023-07-30 Sun 16:49] SCHEDULED: <2023-07-30 Sun 15:00>
:LOGBOOK:
CLOCK: [2023-07-30 Sun 16:06]--[2023-07-30 Sun 16:35] =>  0:29
CLOCK: [2023-07-30 Sun 15:39]--[2023-07-30 Sun 15:40] =>  0:01
:END:
/Entered on/ [2023-04-16 Sun 17:29]
Refaire résultats
*** KILL Platinum genome
CLOSED: [2023-06-14 Wed 22:37]
https://emea.illumina.com/platinumgenomes.html
*** TODO Séquencer NA12878 :cento:hg001:
Discussion avec Paul : sous-traitant ne nous donnera pas les données, il faut commander l'ADN
**** DONE ADN commandé
CLOSED: [2023-06-30 Fri 22:29]
**** DONE Sauvegarder les données brutes
CLOSED: [2023-07-30 Sun 14:22] SCHEDULED: <2023-07-19 Wed>
K, scality, S
**** KILL Récupérer le fichier de capture
CLOSED: [2023-07-30 Sun 14:25] SCHEDULED: <2023-07-23 Sun>
Candidats donnés dans publication https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8354858/
#+begin_quote
In short, the Nextera Rapid Capture Exome Kit (Illumina, San Diego, CA), the SureSelect Human All Exon kit (Agilent, Santa Clara, CA) or the Twist Human Core Exome was used for enrichment, and a Nextseq500, HiSeq4000, or Novoseq 6000 (Illumina) instrument was used for the actual sequencing, with the average coverage targeted to at least 100× or at least 98% of the target DNA covered 20×.
#+end_quote
Par défaut, on utilisera https://www.twistbioscience.com/products/ngs/alliance-panels#tab-3
ANnonce récente pour nouveau panel Twist : https://www.centogene.com/news-events/news/newsdetails/twist-bioscience-and-centogene-launch-three-panels-to-advance-rare-disease-and-hereditary-cancer-research-and-support-diagnostics
Masi pas de fichier BED
***** DONE Mail centogène
CLOSED: [2023-07-30 Sun 14:22] DEADLINE: <2023-07-23 Sun>
**** TODO Tester Nextera Rapid Capture Exome v1.2 (hg19) :giab:
SCHEDULED: <2023-08-02 Wed>
https://support.illumina.com/downloads/nextera-rapid-capture-exome-v1-2-product-files.html
**** DONE Tester Agilen SureSelect All Exon V8 (hg38) :giab:
CLOSED: [2023-07-31 Mon 23:09] SCHEDULED: <2023-07-31 Mon>
https://earray.chem.agilent.com/suredesign/index.htm
"Find design"
"Agilent catalog"
Fichiers:
- Regions.bed: Targeted exon intervals, curated and targeted by Agilent Technologies
- MergedProbes.bed: Merged probes for targeted enrichment of exons described in Regions.bed
- Covered.bed: Merged probes and sequences with 95% homology or above
- Padded.bed: Merged probes and sequences with 95% homology or above extended 50 bp at each side
- AllTracks.bed: Targeted regions and covered tracks
 #+begin_src sh
nextflow run workflows/compareVCF.nf -profile standard,helios --query=out/2300346867_63118093_NA12878-GRCh38/callVariant/haplotypecaller/2300346867_63118093_NA12878-GRCh38.vcf.gz --outdir=out/2300346867_63118093_NA12878-GRCh38/happy/ --compare=happy -lib lib --capture=capture/Agilent_SureSelect_All_Exons_v8_hg38_Regions.bed  --id=HG001 --genome=GRCh38
 #+end_src
| Type  | Filter | TRUTH.TOTAL | TRUTH.TP | TRUTH.FN | QUERY.TOTAL | QUERY.FP | QUERY.UNK | FP.gt | FP.al | METRIC.Recall | METRIC.Precision | METRIC.Frac_NA | METRIC.F1_Score | TRUTH.TOTAL.TiTv_ratio | QUERY.TOTAL.TiTv_ratio | TRUTH.TOTAL.het_hom_ratio | QUERY.TOTAL.het_hom_ratio |
| INDEL | ALL    |         423 |      395 |       28 |         915 |      108 |       405 |     4 |    13 |      0.933806 |         0.788235 |       0.442623 |        0.854868 |                        |                        |        1.7012987012987013 |        2.7916666666666665 |
| INDEL | PASS   |         423 |      395 |       28 |         915 |      108 |       405 |     4 |    13 |      0.933806 |         0.788235 |       0.442623 |        0.854868 |                        |                        |        1.7012987012987013 |        2.7916666666666665 |
| SNP   | ALL    |       20984 |    20600 |      384 |       26080 |      780 |      4703 |    62 |    10 |        0.9817 |         0.963512 |        0.18033 |        0.972521 |     3.0499710592321048 |     2.7596541786743516 |          1.58256372367935 |        1.8978207694018234 |
| SNP   | PASS   |       20984 |    20600 |      384 |       26080 |      780 |      4703 |    62 |    10 |        0.9817 |         0.963512 |        0.18033 |        0.972521 |     3.0499710592321048 |     2.7596541786743516 |          1.58256372367935 |        1.8978207694018234 |
**** DONE Test Twist Human core Exome (hg38):giab:
CLOSED: [2023-08-01 Tue 23:16] SCHEDULED: <202 3-08-02 Wed>
https://www.twistbioscience.com/resources/data-files/ngs-human-core-exome-panel-bed-file
#+begin_src
nextflow run workflows/compareVCF.nf -profile standard,helios --query=out/2300346867_63118093_NA12878-GRCh38/callVariant/haplotypecaller/2300346867_63118093_NA12878-GRCh38.vcf.gz --outdir=out/2300346867_63118093_NA12878-GRCh38/happy-twist-exome-core/ --compare=happy -lib lib --capture=capture/Twist_Exome_Core_Covered_Targets_hg38.bed  --id=HG001 --genome=GRCh38 -bg
#+end_src
| Type  | Filter | TRUTH.TOTAL | TRUTH.TP | TRUTH.FN | QUERY.TOTAL | QUERY.FP | QUERY.UNK | FP.gt | FP.al | METRIC.Recall | METRIC.Precision | METRIC.Frac_NA | METRIC.F1_Score | TRUTH.TOTAL.TiTv_ratio | QUERY.TOTAL.TiTv_ratio | TRUTH.TOTAL.het_hom_ratio | QUERY.TOTAL.het_hom_ratio |
| INDEL | ALL    |         328 |      313 |       15 |         722 |       95 |       309 |     4 |    13 |      0.954268 |         0.769976 |       0.427978 |        0.852273 |                        |                        |        1.8584070796460177 |        2.8967391304347827 |
| INDEL | PASS   |         328 |      313 |       15 |         722 |       95 |       309 |     4 |    13 |      0.954268 |         0.769976 |       0.427978 |        0.852273 |                        |                        |        1.8584070796460177 |        2.8967391304347827 |
| SNP   | ALL    |       19198 |    18962 |      236 |       23381 |      684 |      3738 |    48 |    10 |      0.987707 |         0.965178 |       0.159873 |        0.976313 |     3.1034188034188035 |      2.859264147830391 |        1.5669565217391304 |        1.8578767123287672 |
| SNP   | PASS   |       19198 |    18962 |      236 |       23381 |      684 |      3738 |    48 |    10 |      0.987707 |         0.965178 |       0.159873 |        0.976313 |     3.1034188034188035 |      2.859264147830391 |        1.5669565217391304 |        1.8578767123287672 |
**** KILL Tester si le panel Twist Alliance VCGS Exome suffit
CLOSED: [2023-07-31 Mon 22:31] SCHEDULED: <2023-07-30 Sun>
**** TODO Comparer happy et happy-vcfeval :giab:
SCHEDULED: <2023-08-03 Thu>
** TODO Insilico :cento:
*** TODO tous les variants centogène
**** DONE Extraire liste des SNVs
CLOSED: [2023-04-22 Sat 17:32] SCHEDULED: <2023-04-17 Mon>
***** DONE Corriger manquant à la main
CLOSED: [2023-04-22 Sat 17:31]
La sortie est sauvegardé dans git-annex : variants_success.csv
***** DONE Automatique
CLOSED: [2023-04-22 Sat 17:31]
**** DONE Convert SNVs : transcript -> génomique
CLOSED: [2023-06-03 Sat 17:16]
***** DONE Variant_recoder
CLOSED: [2023-04-26 Wed 21:21] SCHEDULED: <2023-04-22 Sat>
****** KILL Haskell: 160 manquant : recoded-success.csv
CLOSED: [2023-04-25 Tue 18:32]
La liste des variants a été générée en Haskel   l et nettoyée à la main.
On générer une liste de variant pour variant_rec            oder et on soumet tout d'un coup.
[[file:~/recherche/bisonex/parsevariants/app/Main.hs][parsevariant]]
#+begin_src haskell
recodeVariant = do
  prepareVariantRecod   er "variant_success.csv" "renamed.csv"
  runVariantRecoder "renamed.csv" "recoded.json"
#+end_src
#+RESULTS:
: <interactive>:4:3-19: error:
:     Variable not in scope: runVariantRecoder :: String -> String -> t
: gh
Problème : 160 n'ont pas pu être lu sur 820, probablement à cause du numéro mineur de transcrit
La sortie est sauvegardé dans git-annex : variants-recoded-raw.json.
****** KILL Julia
CLOSED: [2023-04-25 Tue 18:32]
On regénère la liste de variant et on passe à Julia pour préparer l'appel en parallèle à variant recoder
[[file:~/recherche/bisonex/parsevariants/variantRecoder.jl][variantRecoder.jl]]
#+begin_src julia
setupVariantRecoder(unique(init), n)
#+end_src
Puis
#+begin_src sh
parallel -a parallel-recoder.sh --jobs 10
#+end_src
On récupère les résultats
#+begin_src julia
(fails, success) = mergeVariantRecoder(n)
CSV.write(fSuccess, success)
CSV.write(fFailures, fails)
#+end_src
Certains variants ne sont pas trouvé, donc on prépare un nouveau job en enlevant les versionrs mineures des transcrits
#+begin_src julia
# Cleanup json and txt
if isfile(fSuccess) && isfile(fFailures)
    foreach(rm, variantRecoderInput())
    foreach(rm, variantRecoderOutput())
end
redoFails(fFailures)
#+end_src
Puis
#+begin_src sh
parallel -a parallel-recoder.sh --jobs 3
#+end_src
Il manque encore 70 transcrits
***** DONE Julia avec mobidetails: recode-failures-mobidetails.csv
CLOSED: [2023-04-25 Tue 18:58]
Nouvelle stratégie : on essaie une fois variant recoder.
Pour tous les échecs, on utilise mobidetails (~170).
Si l'ID n'est pas trouvé, on incrémente le numéro de version 2 fois
***** DONE Reste une dizaine à corriger à la main
CLOSED: [2023-04-26 Wed 21:21]
- [X] certains transcrits ont juste été supprimé
- [X] Erreur de parsing, manque souvent un -
#+begin_src julia
lastTryMobidetails("recoded-failures-mobidetails.csv")
#+end_src
***** DONE Fusionner données
CLOSED: [2023-04-26 Wed 22:35]
#+begin_src julia
function mergeAllGenomic()
    dNew = mergeAll("recoded-success.csv",
                    "recoded-failures-mobidetails.csv",
                    "recoded-failures-mobidetails-redo.csv")
    dInit = @chain DataFrame(CSV.File("variant_success.csv")) begin
        @transform :transcript = :

[10.16869]

[5.16413]

  64 |       340 |     8 |    17 |      0.890710 |         0.885510 |
| SNP   |       21973 |    21462 |      511 |       26285 |      563 |      4263 |    68 |    16 |      0.976744 |         0.974435 |
****** DONE Interesection des bed: similaire
CLOSED: [2023-07-04 Tue 23:11]
HG38
 #+begin_src sh
 bedtools intersect -a capture/Agilent_SureSelect_All_Exons_v7_hg38_Regions.bed -b /Work/Groups/bisonex/data/giab/GRCh38/HG001_GRCh38_1_22_v4.2.1_benchmark.bed  | wc -l
 #+end_src
 204280
 T2T
 #+begin_src sh
 bedtools intersect -a /Work/Groups/bisonex/data/giab/T2T/Agilent_SureSelect_All_Exons_v7_hg38_Regions_hg38_T2T.bed -b /Work/Groups/bisonex/data/giab/T2T/HG001_GRCh38_1_22_v4.2.1_benchmark_hg38_T2T.bed  | wc -l
 #+end_src
 204021
****** DONE Vérifier la ligne de commande
CLOSED: [2023-07-04 Tue 23:38]
#+begin_src sh
hap.py \
    HG001_GRCh38_1_22_v4_lifted_merged.vcf.gz \
    HG001-SRX11061486_SRR14724513-T2T.vcf.gz \
     \
    --reference chm13v2.0.fa \
    --threads 6 \
     \
    -T Agilent_SureSelect_All_Exons_v7_hg38_Regions_hg38_T2T.bed \
    --false-positives HG001_GRCh38_1_22_v4.2.1_benchmark_hg38_T2T.bed \
     \
    -o HG001
#+end_src
****** DONE Corriger FILTER : mieux mais toujours trop de négatifs. 3/4 SNP retrouvés
CLOSED: [2023-07-08 Sat 15:19] SCHEDULED: <2023-07-08 Sat>
 Type Filter  TRUTH.TOTAL  TRUTH.TP  TRUTH.FN  QUERY.TOTAL  QUERY.FP  QUERY.UNK  FP.gt  FP.al  METRIC.Recall  METRIC.Precision  METRIC.Frac_NA  METRIC.F1_Score  TRUTH.TOTAL.TiTv_ratio  QUERY.TOTAL.TiTv_ratio  TRUTH.TOTAL.het_hom_ratio  QUERY.TOTAL.het_hom_ratio
INDEL    ALL          413       246       167          751       289        215      2     98       0.595642          0.460821        0.286285         0.519629                     NaN                     NaN                   2.428571                   2.465116
INDEL   PASS          413       246       167          751       289        215      2     98       0.595642          0.460821        0.286285         0.519629                     NaN                     NaN                   2.428571                   2.465116
  SNP    ALL        15883     15479       404        23597      5277       2841     46     44       0.974564          0.745760        0.120397         0.844947                3.017198                 2.85705                   5.560099                   2.114633
  SNP   PASS        15883     15479       404        23597      5277       2841     46     44       0.974564          0.745760        0.120397         0.844947                3.017198                 2.85705                   5.560099                   2.114633
******* DONE Vérifier qu'il ne reste plus de filtre autre que PASS
CLOSED: [2023-07-08 Sat 15:19]
#+begin_src
$ zgrep -c 'PASS' HG001_GRCh38_1_22_v4_lifted_merged.vcf.gz
3730505
$ zgrep -c '^chr' HG001_GRCh38_1_22_v4_lifted_merged.vcf.gz
3730506
#+end_src
****** TODO 1/4 SNP manquant ?
******* DONE Regarder avec Julia si ce sont vraiment des FP: 61/5277 qui ne le sont pas
CLOSED: [2023-07-09 Sun 12:09]
******* DONE Examiner les FP
CLOSED: [2023-07-30 Sun 22:05]
******* DONE Tester un FP
CLOSED: [2023-07-30 Sun 22:05]
  2 │ chr1        608765  A           G           ./.:.:.:.:NOCALL:nocall:.  1/1:FP:.:ti:SNP:homalt:188
  liftDown UCSC: rien en GIAB : vrai FP
 3 │ chr1        762943  A           G           ./.:.:.:.:NOCALL:nocall:.  1/1:FP:.:ti:SNP:homalt:287
 4 │ chr1        762945  A           T           ./.:.:.:.:NOCALL:nocall:.  1/1:FP:.:tv:SNP:homalt:287
 Remaniements complexes ? Pas dans le gène en HG38
******* DONE La plupart des FP (4705/5566) sont homozygotes: erreur de référence ?
CLOSED: [2023-07-12 Wed 21:10] SCHEDULED: <2023-07-09 Sun>
Sur les 2 premiers variants, ils montrent en fait la différence entre T2T et GRCh38
Erreur à l'alignement ?
******** KILL relancer l'alignement
CLOSED: [2023-07-09 Sun 17:36]
******** DONE vérifier reads identiques hg38 et T2T: oui
CLOSED: [2023-07-09 Sun 16:36]
T2T CHR1608765
38   	chr1:1180168-1180168 (
SRR14724513.24448214
SRR14724513.24448214
******* TODO Enlever les FP qui correspondent à un changement dans le génome
******** Condition:
- pas de variation à la position en GRCh38
- variantion homozygote
- la varation en T2T correspond au changement de pair de base GRC38 -> T2T
  pour les SNP:
  alt_T2T[i] = DNA_GRC38[j]
  avec i la position en T2T et j la position en GRCh38
  Note: définir un ID n'est pas correct car les variants peuvent être modifié par happy !
******** Idée
 - Pour chaque FP, c'est un "faux" FP si
     - REF en hg38 == ALT en T2T
     - et REF en hg38 != REF en T2T
     - et variant homozygote
Comment obtenir les séquences de réferences ?
1. liftover
2. blat sur la séquence autour du variant
3. identifier quelques reads contenant le variant et regarder leur aligneement en hg38
Après discussion avec Alexis: solution 3
******** Algorithme
1. Extraire les coordonnées en T2T des faux positifs *homozygote*
2. Pour chaque faux positif
   1. lister 10 reads contenant le variant
   2. pour chacun de ces reads, récupérer la séquence en T2T et GRCh38 via le nom du read dans le bam
   3. si la séquence en T2T modifiée par le variant est "identique" à celle en GRCh38, alors on ignore ce faux positif
Note: on ignore les reads qui ont changé de chromosome entre les version
******** DONE Résultat préliminaire
CLOSED: [2023-07-23 Sun 14:30]
cf [[file:~/roam/research/bisonex/code/giab/giab-corrected.csv][script julia]]
3498 faux positifs en moins, soit 0.89 sensibilité
julia> tp=15479
julia> fp=5277
julia> tp/(tp+fp)
0.7457602620928888
julia> tp/(tp+(fp-3498))
0.8969173716537258
On est toujours en dessous des 97%
******** PROJ Corriger proprement VCF ou résultats Happy
******* DONE Vérifier quelques variants sur IGV
CLOSED: [2023-07-09 Sun 17:36]
******* KILL Répartition des FP : cluster ?
CLOSED: [2023-07-09 Sun 17:36]
******* PROJ Examiner les FP restant après correction selon séquence de référence
******* PROJ Examiner les variants supprimé
****** KILL Méthodologie du pangenome
CLOSED: [2023-07-31 Mon 22:29] SCHEDULED: <2023-07-30 Sun>
***** KILL Mail Yannis
CLOSED: [2023-07-08 Sat 10:44]
***** DONE Mail GIAB pour version T2T
CLOSED: [2023-07-07 Fri 18:37]
**** TODO HG002 :hg002:T2T:
**** TODO HG003 :hg003:T2T:
**** TODO HG004 :hg004:T2T:
**** DONE Plot : ashkenazim trio :hg38:
CLOSED: [2023-07-30 Sun 16:49] SCHEDULED: <2023-07-30 Sun 15:00>
:LOGBOOK:
CLOCK: [2023-07-30 Sun 16:06]--[2023-07-30 Sun 16:35] =>  0:29
CLOCK: [2023-07-30 Sun 15:39]--[2023-07-30 Sun 15:40] =>  0:01
:END:
/Entered on/ [2023-04-16 Sun 17:29]
Refaire résultats
*** KILL Platinum genome
CLOSED: [2023-06-14 Wed 22:37]
https://emea.illumina.com/platinumgenomes.html
*** TODO Séquencer NA12878 :cento:hg001:
Discussion avec Paul : sous-traitant ne nous donnera pas les données, il faut commander l'ADN
**** DONE ADN commandé
CLOSED: [2023-06-30 Fri 22:29]
**** DONE Sauvegarder les données brutes
CLOSED: [2023-07-30 Sun 14:22] SCHEDULED: <2023-07-19 Wed>
K, scality, S
**** KILL Récupérer le fichier de capture
CLOSED: [2023-07-30 Sun 14:25] SCHEDULED: <2023-07-23 Sun>
Candidats donnés dans publication https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8354858/
#+begin_quote
In short, the Nextera Rapid Capture Exome Kit (Illumina, San Diego, CA), the SureSelect Human All Exon kit (Agilent, Santa Clara, CA) or the Twist Human Core Exome was used for enrichment, and a Nextseq500, HiSeq4000, or Novoseq 6000 (Illumina) instrument was used for the actual sequencing, with the average coverage targeted to at least 100× or at least 98% of the target DNA covered 20×.
#+end_quote
Par défaut, on utilisera https://www.twistbioscience.com/products/ngs/alliance-panels#tab-3
ANnonce récente pour nouveau panel Twist : https://www.centogene.com/news-events/news/newsdetails/twist-bioscience-and-centogene-launch-three-panels-to-advance-rare-disease-and-hereditary-cancer-research-and-support-diagnostics
Masi pas de fichier BED
***** DONE Mail centogène
CLOSED: [2023-07-30 Sun 14:22] DEADLINE: <2023-07-23 Sun>
**** TODO Tester Nextera Rapid Capture Exome v1.2 (hg19) :giab:
SCHEDULED: <2023-08-03 Thu 19:00>
https://support.illumina.com/downloads/nextera-rapid-capture-exome-v1-2-product-files.html
**** DONE Tester Agilent SureSelect All Exon V8 (hg38) :giab:
CLOSED: [2023-07-31 Mon 23:09] SCHEDULED: <2023-07-31 Mon>
https://earray.chem.agilent.com/suredesign/index.htm
"Find design"
"Agilent catalog"
Fichiers:
- Regions.bed: Targeted exon intervals, curated and targeted by Agilent Technologies
- MergedProbes.bed: Merged probes for targeted enrichment of exons described in Regions.bed
- Covered.bed: Merged probes and sequences with 95% homology or above
- Padded.bed: Merged probes and sequences with 95% homology or above extended 50 bp at each side
- AllTracks.bed: Targeted regions and covered tracks
 #+begin_src sh
nextflow run workflows/compareVCF.nf -profile standard,helios --query=out/2300346867_63118093_NA12878-GRCh38/callVariant/haplotypecaller/2300346867_63118093_NA12878-GRCh38.vcf.gz --outdir=out/2300346867_63118093_NA12878-GRCh38/happy/ --compare=happy -lib lib --capture=capture/Agilent_SureSelect_All_Exons_v8_hg38_Regions.bed  --id=HG001 --genome=GRCh38
 #+end_src
| Type  | Filter | TRUTH.TOTAL | TRUTH.TP | TRUTH.FN | QUERY.TOTAL | QUERY.FP | QUERY.UNK | FP.gt | FP.al | METRIC.Recall | METRIC.Precision | METRIC.Frac_NA | METRIC.F1_Score | TRUTH.TOTAL.TiTv_ratio | QUERY.TOTAL.TiTv_ratio | TRUTH.TOTAL.het_hom_ratio | QUERY.TOTAL.het_hom_ratio |
| INDEL | ALL    |         423 |      395 |       28 |         915 |      108 |       405 |     4 |    13 |      0.933806 |         0.788235 |       0.442623 |        0.854868 |                        |                        |        1.7012987012987013 |        2.7916666666666665 |
| INDEL | PASS   |         423 |      395 |       28 |         915 |      108 |       405 |     4 |    13 |      0.933806 |         0.788235 |       0.442623 |        0.854868 |                        |                        |        1.7012987012987013 |        2.7916666666666665 |
| SNP   | ALL    |       20984 |    20600 |      384 |       26080 |      780 |      4703 |    62 |    10 |        0.9817 |         0.963512 |        0.18033 |        0.972521 |     3.0499710592321048 |     2.7596541786743516 |          1.58256372367935 |        1.8978207694018234 |
| SNP   | PASS   |       20984 |    20600 |      384 |       26080 |      780 |      4703 |    62 |    10 |        0.9817 |         0.963512 |        0.18033 |        0.972521 |     3.0499710592321048 |     2.7596541786743516 |          1.58256372367935 |        1.8978207694018234 |
**** DONE Test Twist Human core Exome (hg38):giab:
CLOSED: [2023-08-01 Tue 23:16] SCHEDULED: <202 3-08-02 Wed>
https://www.twistbioscience.com/resources/data-files/ngs-human-core-exome-panel-bed-file
#+begin_src
nextflow run workflows/compareVCF.nf -profile standard,helios --query=out/2300346867_63118093_NA12878-GRCh38/callVariant/haplotypecaller/2300346867_63118093_NA12878-GRCh38.vcf.gz --outdir=out/2300346867_63118093_NA12878-GRCh38/happy-twist-exome-core/ --compare=happy -lib lib --capture=capture/Twist_Exome_Core_Covered_Targets_hg38.bed  --id=HG001 --genome=GRCh38 -bg
#+end_src
| Type  | Filter | TRUTH.TOTAL | TRUTH.TP | TRUTH.FN | QUERY.TOTAL | QUERY.FP | QUERY.UNK | FP.gt | FP.al | METRIC.Recall | METRIC.Precision | METRIC.Frac_NA | METRIC.F1_Score | TRUTH.TOTAL.TiTv_ratio | QUERY.TOTAL.TiTv_ratio | TRUTH.TOTAL.het_hom_ratio | QUERY.TOTAL.het_hom_ratio |
| INDEL | ALL    |         328 |      313 |       15 |         722 |       95 |       309 |     4 |    13 |      0.954268 |         0.769976 |       0.427978 |        0.852273 |                        |                        |        1.8584070796460177 |        2.8967391304347827 |
| INDEL | PASS   |         328 |      313 |       15 |         722 |       95 |       309 |     4 |    13 |      0.954268 |         0.769976 |       0.427978 |        0.852273 |                        |                        |        1.8584070796460177 |        2.8967391304347827 |
| SNP   | ALL    |       19198 |    18962 |      236 |       23381 |      684 |      3738 |    48 |    10 |      0.987707 |         0.965178 |       0.159873 |        0.976313 |     3.1034188034188035 |      2.859264147830391 |        1.5669565217391304 |        1.8578767123287672 |
| SNP   | PASS   |       19198 |    18962 |      236 |       23381 |      684 |      3738 |    48 |    10 |      0.987707 |         0.965178 |       0.159873 |        0.976313 |     3.1034188034188035 |      2.859264147830391 |        1.5669565217391304 |        1.8578767123287672 |
**** TODO Test Twist Human core Exome (hg38):giab:
SCHEDULED: <2023-08-03 Thu 20:00>
**** TODO Tester Agilen SureSelect All Exon V8 (hg38) GATK-4.4:giab:
SCHEDULED: <2023-08-03 Thu 20:00>
**** KILL Tester si le panel Twist Alliance VCGS Exome suffit
CLOSED: [2023-07-31 Mon 22:31] SCHEDULED: <2023-07-30 Sun>
**** TODO Comparer happy et happy-vcfeval :giab:
SCHEDULED: <2023-08-03 Thu>
** TODO Insilico :cento:
*** TODO tous les variants centogène
**** DONE Extraire liste des SNVs
CLOSED: [2023-04-22 Sat 17:32] SCHEDULED: <2023-04-17 Mon>
***** DONE Corriger manquant à la main
CLOSED: [2023-04-22 Sat 17:31]
La sortie est sauvegardé dans git-annex : variants_success.csv
***** DONE Automatique
CLOSED: [2023-04-22 Sat 17:31]
**** DONE Convert SNVs : transcript -> génomique
CLOSED: [2023-06-03 Sat 17:16]
***** DONE Variant_recoder
CLOSED: [2023-04-26 Wed 21:21] SCHEDULED: <2023-04-22 Sat>
****** KILL Haskell: 160 manquant : recoded-success.csv
CLOSED: [2023-04-25 Tue 18:32]
La liste des variants a été générée en Haskel   l et nettoyée à la main.
On générer une liste de variant pour variant_rec            oder et on soumet tout d'un coup.
[[file:~/recherche/bisonex/parsevariants/app/Main.hs][parsevariant]]
#+begin_src haskell
recodeVariant = do
  prepareVariantRecod   er "variant_success.csv" "renamed.csv"
  runVariantRecoder "renamed.csv" "recoded.json"
#+end_src
#+RESULTS:
: <interactive>:4:3-19: error:
:     Variable not in scope: runVariantRecoder :: String -> String -> t
: gh
Problème : 160 n'ont pas pu être lu sur 820, probablement à cause du numéro mineur de transcrit
La sortie est sauvegardé dans git-annex : variants-recoded-raw.json.
****** KILL Julia
CLOSED: [2023-04-25 Tue 18:32]
On regénère la liste de variant et on passe à Julia pour préparer l'appel en parallèle à variant recoder
[[file:~/recherche/bisonex/parsevariants/variantRecoder.jl][variantRecoder.jl]]
#+begin_src julia
setupVariantRecoder(unique(init), n)
#+end_src
Puis
#+begin_src sh
parallel -a parallel-recoder.sh --jobs 10
#+end_src
On récupère les résultats
#+begin_src julia
(fails, success) = mergeVariantRecoder(n)
CSV.write(fSuccess, success)
CSV.write(fFailures, fails)
#+end_src
Certains variants ne sont pas trouvé, donc on prépare un nouveau job en enlevant les versionrs mineures des transcrits
#+begin_src julia
# Cleanup json and txt
if isfile(fSuccess) && isfile(fFailures)
    foreach(rm, variantRecoderInput())
    foreach(rm, variantRecoderOutput())
end
redoFails(fFailures)
#+end_src
Puis
#+begin_src sh
parallel -a parallel-recoder.sh --jobs 3
#+end_src
Il manque encore 70 transcrits
***** DONE Julia avec mobidetails: recode-failures-mobidetails.csv
CLOSED: [2023-04-25 Tue 18:58]
Nouvelle stratégie : on essaie une fois variant recoder.
Pour tous les échecs, on utilise mobidetails (~170).
Si l'ID n'est pas trouvé, on incrémente le numéro de version 2 fois
***** DONE Reste une dizaine à corriger à la main
CLOSED: [2023-04-26 Wed 21:21]
- [X] certains transcrits ont juste été supprimé
- [X] Erreur de parsing, manque souvent un -
#+begin_src julia
lastTryMobidetails("recoded-failures-mobidetails.csv")
#+end_src
***** DONE Fusionner données
CLOSED: [2023-04-26 Wed 22:35]
#+begin_src julia
function mergeAllGenomic()
    dNew = mergeAll("recoded-success.csv",
                    "recoded-failures-mobidetails.csv",
                    "recoded-failures-mobidetails-redo.csv")
    dInit = @chain DataFrame(CSV.File("variant_success.csv")) begin
        @transform :transcript = :

Replacement in projects/bisonex.org at line 53 [8.35]

B:BD[10.31471] → [10.31471:35717]

43101    128
browser details YourSeq    23     1    25   128    96.0%  chr19                 -    33396097  33396121     25
Second
--------------------------------------------------------------------------------------------------------------
browser details YourSeq   126     1   128   128    99.3%  chr15_ML143370v1_fix  -      172243    172370    128   What is chrom_fix?
browser details YourSeq   126     1   128   128    99.3%  chr15                 -    74342974  74343101    128
browser details YourSeq    23   104   128   128    96.0%  chr19                 +    33396097  33396121     25
******** DONE Bwa mem à la main GRCh38.p13 : on est dans une zone NW
CLOSED: [2023-06-04 Sun 21:51]
On met les 2 reads dans des fichiers séparés puis
#+begin_src sh
cd /Work/Users/apraga/bisonex/tests/xamscissors/align
bwa mem /Work/Groups/bisonex/data/genome/GRCh38.p13/bwa/genomeRef test1.fq test2.fq
#+end_src
A00853:477:HMLWYDSX3:2:2444:22354:28870	97	NW_021160016.1	172243	0	128M	=	172243	128	CACCGTGTCCACCCCTCCTGCCGGCATCTCTGTGACGTTGGCCTTGATGTCCTTGAAGGACATCTTGCTGTCTCCCAGGAGTCTGTAGAGGATGCCACGGTAATCGTGGTGAACACTTCCTTTCTGTC	FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFF:FFFFFFFFFF::FFFFFFFFFFF:FFFFFFFFFFFFFF:FFFFFFF,FFFFFF,FFFFFFFFFFFF:FF::FF	NM:i:2	MD:Z:22A30C7MC:Z:128M	AS:i:118	XS:i:118	XA:Z:NC_000015.10,+74342974,128M,2;
A00853:477:HMLWYDSX3:2:2444:22354:28870	145	NW_021160016.1	172243	0	128M	=	172243	-128	CACCGTGTCCACCCCTCCTGCCGGCATCTCTGTGACGTTGGCCTTGATGTCCTCGAAGGACATCTTGCTGTCTCCCAGGAGTCTGTAGAGGATGCCACGGTAATCGTGGTGAACACTTCCTTTCTGTC	FFFFFFFFFFFFF:FFFFFF,FFF:,FFFFFFFFFFFFFFFF:FFFFFFFFFFFFFF:FF:F:FFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FF:FFF:FF	NM:i:1	MD:Z:22A105	MC:Z:128M	AS:i:123	XS:i:123	XA:Z:NC_000015.10,-74342974,128M,1;
******** DONE GRCh38.p14: idem
CLOSED: [2023-06-04 Sun 21:51]
A00853:477:HMLWYDSX3:2:2444:22354:28870	97	NW_021160016.1	172243	0	128M	=	172243	128	CACCGTGTCCACCCCTCCTGCCGGCATCTCTGTGACGTTGGCCTTGATGTCCTTGAAGGACATCTTGCTGTCTCCCAGGAGTCTGTAGAGGATGCCACGGTAATCGTGGTGAACACTTCCTTTCTGTC	FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFF:FFFFFFFFFF::FFFFFFFFFFF:FFFFFFFFFFFFFF:FFFFFFF,FFFFFF,FFFFFFFFFFFF:FF::FF	NM:i:2	MD:Z:22A30C7MC:Z:128M	AS:i:118	XS:i:118	XA:Z:NC_000015.10,+74342974,128M,2;
A00853:477:HMLWYDSX3:2:2444:22354:28870	145	NW_021160016.1	172243	0	128M	=	172243	-128	CACCGTGTCCACCCCTCCTGCCGGCATCTCTGTGACGTTGGCCTTGATGTCCTCGAAGGACATCTTGCTGTCTCCCAGGAGTCTGTAGAGGATGCCACGGTAATCGTGGTGAACACTTCCTTTCTGTC	FFFFFFFFFFFFF:FFFFFF,FFF:,FFFFFFFFFFFFFFFF:FFFFFFFFFFFFFF:FF:F:FFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FF:FFF:FF	NM:i:1	MD:Z:22A105	MC:Z:128M	AS:i:123	XS:i:123	XA:Z:NC_000015.10,-74342974,128M,1;
******** DONE GRCh38 : ok
CLOSED: [2023-06-04 Sun 22:15]
 bwa mem /Work/Projects/bisonex/data/genome/GRCh38/GCA_000001405.15_GRCh38_full_analysis_set.fna test1.fq test2.fq
******* DONE Vérifier que les reads ont la même qualité sur les fichiers d'origine: oui
CLOSED: [2023-06-04 Sun 21:07]
******* DONE Supprimer les NW_ ?
CLOSED: [2023-06-10 Sat 10:40] SCHEDULED: <2023-06-04 Sun>
@A00853:477:HMLWYDSX3:3:2114:14742:8860
CAGGCCAGCCGCTCAGCCCGCTCCTTTCACCCTCTGCAGGAGAGCCTCGTGGCAGGCCAGTGGAGGGACATGATGGACTACATGCTCCAAGGGGTGGCGCAGCCGAGCATGGAAGAGGGCTCTGGACAGCTCCTGGAAGGGCACTTGCAC
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
@A00853:477:HMLWYDSX3:3:2114:14742:8860
CTTTTGCTTGTCCCCAGGACGCACCTCAGGGTGGTGAAGCAAAAAAACCACGGCCCAGGAGAGGGTGGGTGCTGTGGTCTCAGTGCCACCGATCAGGAGGTCCACTGCAGCCATGTGCAAGTGCCCTTCCAGGAGCTGTCCAGAGCCCTCT
+
FFFFFFFFFFFFFFFFFFFFFFF:FFF:FFFFFFFFFFFFF,FFFFFFFFFFFF:F:FFFF:FFFFF,,FFF:FFFFFFFFFF,FFFFFFF,FFFFFFFFFFF,FFFFFFFFF:FFFF,F:FFFFF:FFFFFFFFF:FFFF,FFFFFFFFF
******* DONE Supprimer NW_ et NT_
****** PROJ Phase 2 : chr22, vaf variable :T2T:
****** TODO Phase 3 : tous SNV, vaf variable :T2T:
***** TODO Test Indel
**** Divers
***** DONE Vérifier nombre de reads fastq - bam
CLOSED: [2022-10-09 Sun 22:31]
*** KILL Liste varants "clinically relevent" (Clinge - CT-R d)
CLOSED: [2023-06-25 Sun 15:53] SCHEDULED: <2023-06-25 Sun>
[cite:@wilcox2021]
Vu avec alexis: pas notre cas d'usage

[10.31471]

43101    128
browser details YourSeq    23     1    25   128    96.0%  chr19                 -    33396097  33396121     25
Second
--------------------------------------------------------------------------------------------------------------
browser details YourSeq   126     1   128   128    99.3%  chr15_ML143370v1_fix  -      172243    172370    128   What is chrom_fix?
browser details YourSeq   126     1   128   128    99.3%  chr15                 -    74342974  74343101    128
browser details YourSeq    23   104   128   128    96.0%  chr19                 +    33396097  33396121     25
******** DONE Bwa mem à la main GRCh38.p13 : on est dans une zone NW
CLOSED: [2023-06-04 Sun 21:51]
On met les 2 reads dans des fichiers séparés puis
#+begin_src sh
cd /Work/Users/apraga/bisonex/tests/xamscissors/align
bwa mem /Work/Groups/bisonex/data/genome/GRCh38.p13/bwa/genomeRef test1.fq test2.fq
#+end_src
A00853:477:HMLWYDSX3:2:2444:22354:28870	97	NW_021160016.1	172243	0	128M	=	172243	128	CACCGTGTCCACCCCTCCTGCCGGCATCTCTGTGACGTTGGCCTTGATGTCCTTGAAGGACATCTTGCTGTCTCCCAGGAGTCTGTAGAGGATGCCACGGTAATCGTGGTGAACACTTCCTTTCTGTC	FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFF:FFFFFFFFFF::FFFFFFFFFFF:FFFFFFFFFFFFFF:FFFFFFF,FFFFFF,FFFFFFFFFFFF:FF::FF	NM:i:2	MD:Z:22A30C7MC:Z:128M	AS:i:118	XS:i:118	XA:Z:NC_000015.10,+74342974,128M,2;
A00853:477:HMLWYDSX3:2:2444:22354:28870	145	NW_021160016.1	172243	0	128M	=	172243	-128	CACCGTGTCCACCCCTCCTGCCGGCATCTCTGTGACGTTGGCCTTGATGTCCTCGAAGGACATCTTGCTGTCTCCCAGGAGTCTGTAGAGGATGCCACGGTAATCGTGGTGAACACTTCCTTTCTGTC	FFFFFFFFFFFFF:FFFFFF,FFF:,FFFFFFFFFFFFFFFF:FFFFFFFFFFFFFF:FF:F:FFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FF:FFF:FF	NM:i:1	MD:Z:22A105	MC:Z:128M	AS:i:123	XS:i:123	XA:Z:NC_000015.10,-74342974,128M,1;
******** DONE GRCh38.p14: idem
CLOSED: [2023-06-04 Sun 21:51]
A00853:477:HMLWYDSX3:2:2444:22354:28870	97	NW_021160016.1	172243	0	128M	=	172243	128	CACCGTGTCCACCCCTCCTGCCGGCATCTCTGTGACGTTGGCCTTGATGTCCTTGAAGGACATCTTGCTGTCTCCCAGGAGTCTGTAGAGGATGCCACGGTAATCGTGGTGAACACTTCCTTTCTGTC	FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFF:FFFFFFFFFF::FFFFFFFFFFF:FFFFFFFFFFFFFF:FFFFFFF,FFFFFF,FFFFFFFFFFFF:FF::FF	NM:i:2	MD:Z:22A30C7MC:Z:128M	AS:i:118	XS:i:118	XA:Z:NC_000015.10,+74342974,128M,2;
A00853:477:HMLWYDSX3:2:2444:22354:28870	145	NW_021160016.1	172243	0	128M	=	172243	-128	CACCGTGTCCACCCCTCCTGCCGGCATCTCTGTGACGTTGGCCTTGATGTCCTCGAAGGACATCTTGCTGTCTCCCAGGAGTCTGTAGAGGATGCCACGGTAATCGTGGTGAACACTTCCTTTCTGTC	FFFFFFFFFFFFF:FFFFFF,FFF:,FFFFFFFFFFFFFFFF:FFFFFFFFFFFFFF:FF:F:FFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FF:FFF:FF	NM:i:1	MD:Z:22A105	MC:Z:128M	AS:i:123	XS:i:123	XA:Z:NC_000015.10,-74342974,128M,1;
******** DONE GRCh38 : ok
CLOSED: [2023-06-04 Sun 22:15]
 bwa mem /Work/Projects/bisonex/data/genome/GRCh38/GCA_000001405.15_GRCh38_full_analysis_set.fna test1.fq test2.fq
******* DONE Vérifier que les reads ont la même qualité sur les fichiers d'origine: oui
CLOSED: [2023-06-04 Sun 21:07]
******* DONE Supprimer les NW_ ?
CLOSED: [2023-06-10 Sat 10:40] SCHEDULED: <2023-06-04 Sun>
@A00853:477:HMLWYDSX3:3:2114:14742:8860
CAGGCCAGCCGCTCAGCCCGCTCCTTTCACCCTCTGCAGGAGAGCCTCGTGGCAGGCCAGTGGAGGGACATGATGGACTACATGCTCCAAGGGGTGGCGCAGCCGAGCATGGAAGAGGGCTCTGGACAGCTCCTGGAAGGGCACTTGCAC
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
@A00853:477:HMLWYDSX3:3:2114:14742:8860
CTTTTGCTTGTCCCCAGGACGCACCTCAGGGTGGTGAAGCAAAAAAACCACGGCCCAGGAGAGGGTGGGTGCTGTGGTCTCAGTGCCACCGATCAGGAGGTCCACTGCAGCCATGTGCAAGTGCCCTTCCAGGAGCTGTCCAGAGCCCTCT
+
FFFFFFFFFFFFFFFFFFFFFFF:FFF:FFFFFFFFFFFFF,FFFFFFFFFFFF:F:FFFF:FFFFF,,FFF:FFFFFFFFFF,FFFFFFF,FFFFFFFFFFF,FFFFFFFFF:FFFF,F:FFFFF:FFFFFFFFF:FFFF,FFFFFFFFF
******* DONE Supprimer NW_ et NT_
****** PROJ Phase 2 : chr22, vaf variable :T2T:
****** TODO Phase 3 : tous SNV, vaf variable :T2T:
***** TODO Test Indel
**** Divers
***** DONE Vérifier nombre de reads fastq - bam
CLOSED: [2022-10-09 Sun 22:31]
*** KILL Liste varants "clinically relevent" (Clinge - CT-R d)
CLOSED: [2023-06-25 Sun 15:53] SCHEDULED: <2023-06-25 Sun>
[cite:@wilcox2021]
Vu avec alexis: pas notre cas d'usage
* TODO Relancer comparaison GIAB avec GATK 4.4.0
SCHEDULED: <2023-08-13 Sun>
/Entered on/ [2023-08-03 Thu 12:42]

Insertion in notes/medecine/20230707211207-ist.org at line 101 [12.99]

[4.1272]


* Syphilis - /Treponema pallidum/
** Primaire
- transmission sexuelle
- incubation 10-90 non contagieuse
- *chancre* ulcération en général unique, base indurées, fondr propre, non douloureux (organes génitaux, ORL, anal)
** Secondaire
- dans l'année
- latente précoe = asymptomatique
- symptomatique = secondaire : succession d'éruption cutanées +/- neuro, oculaire mais *grande simulatrice*
** Tertiaire
- latente tardive = asymptomatique
- tertaire = tous les organes, grandes diversité
** Diagnostic biologique
- *état frais* (pas de coloration)
- *non colorable au gram*, bacilles hélicoïdaaux  moblise
- *non cultivable*
- *sérologie*
  - classique (TT ou TPHA) = anticorps contre une protéine de membrane (TPHA, imunmuno-enzymatique) = spécifique mais cicatrice sérologique...
  - non spécifique (TNT = non trépnoméique ou VDRL): antigène de type phospholipdes (membrane mais aussi mitochrondries) par agglutintation
    -> infection active mais *peu spécifique*
    |      | TT+                        | TT -         |
    |------+----------------------------+--------------|
    | TNT+ | active ou récemment traité | faux positif |
    | TNT- | traité et guérie           | trop précoce |
** Cas particuliers
- dépistage 1er trimestre de la grosses (dramatique foetus)
- neurosyphilis : PCR (passage naturel IgG spécifique donc le test classique a peu d'intérêt)

Replacement in notes/medecine/20230528225531-bacteries.org at line 362 [14.10483]
B:BD[13.536] → [3.150:151]
[13.536]
[14.19741]
```
** Syphilis - /Treponema pallidum/
- *non colorable au gram*
- *non cultivable*
```
Insertion in notes/medecine/20230528225221-classification_bacteries.org at line 104 [14.20341]
[2.1225]
[2.1225]
```
*polaire = entérobactéries*, *péritrice = pseudomonas aeruginosa*
```