apraga/org - Change 4MSZS47PX5OIKGBAMWYPHM5V6NJEWUWE4LNEPFXT4AIIU6MOB5AAC

Adding back cooking + deploying

Created by Alexis Praga on December 17, 2023

4MSZS47PX5OIKGBAMWYPHM5V6NJEWUWE4LNEPFXT4AIIU6MOB5AAC

Dependencies

In channels

main

Change contents

Insertion in site.hs at line 16 [6.9907]

[4.190]

[5.1238]

notesOther = ["notes/japonais.org", "notes/cooking.org"]

Replacement in site.hs at line 40 [6.9907]
B:BD[7.107] → [4.191:227]
```
    match "notes/japonais.org" $ do
```
[7.107]
[4.227]
```
    match (fromList notesOther) $ do
```

Replacement in site.hs at line 42 [6.9907]

B:BD[4.263] → [4.263:327]

        compile $ pandocCompiler
            >>= relativizeUrls

[4.263]

[4.327]

        compile $ pandocCompiler >>= relativizeUrls

Replacement in site.hs at line 68 [6.9907]

B:BD[8.469] → [4.364:439]

            notes' <- loadAll . fromList $ "notes/japonais.org" : notesTOC

[8.469]

[8.513]

            notes' <- loadAll . fromList $ notesTOC ++ notesOther

Insertion in projects.org at line 80 [10.123895]

[9.2590]

** TODO Transférer Harry Potter 1 + thriller pour Yvain
SCHEDULED: <2023-12-17 Sun>
/Entered on/ [2023-12-16 Sat 19:05]
** TODO Commander cadeau Élise
SCHEDULED: <2023-12-16 Sat>
/Entered on/ [2023-12-16 Sat 19:15]

Replacement in projects.org at line 413 [10.123895]
B:BD[11.36] → [12.138:166]
```
SCHEDULED: <2023-12-14 Thu>
```
[11.36]
[11.64]
```
SCHEDULED: <2023-12-21 Thu>
```
Replacement in projects.org at line 478 [10.123895]
B:BD[9.7092] → [13.439:467]
```
SCHEDULED: <2023-12-15 Fri>
```
[9.7092]
[9.7120]
```
SCHEDULED: <2023-12-22 Fri>
```
Replacement in projects.org at line 628 [10.123895]
B:BD[14.361] → [13.468:496]
```
SCHEDULED: <2023-12-16 Sat>
```
[14.361]
[14.389]
```
SCHEDULED: <2023-12-17 Sun>
```
Replacement in projects.org at line 631 [10.123895]
B:BD[14.471] → [13.497:525]
```
SCHEDULED: <2023-12-16 Sat>
```
[14.471]
[15.14]
```
SCHEDULED: <2023-12-17 Sun>
```

Insertion in projects.org at line 1033 [10.123895]

[13.661]

** DONE Page nushell
CLOSED: [2023-12-15 Fri 18:34] SCHEDULED: <2023-12-15 Fri>
/Entered on/ [2023-12-15 Fri 17:19]
** DONE Ebuild julia 1.9.4
CLOSED: [2023-12-16 Sat 22:16] SCHEDULED: <2023-12-15 Fri>
/Entered on/ [2023-12-15 Fri 18:40]
1. Ne peut pas installer une version "custom" LLVM pour problème de droit
   (voir /var/tmp/portage/dev-lang/julia-1.9.4/work/julia-1.9.4/deps/scratch/llvm-julia-14.0.6-3/build_Release/cmake_install.cmake)
  bindings/ocaml/cmake_install.cmake:47 (include)
  cmake_install.cmake:76 (include)
 * ACCESS DENIED:  unlink:             /usr/lib64/ocaml/llvm/llvm.mli
 * ACCESS DENIED:  open_wr:            /usr/lib64/ocaml/llvm/llvm.mli
 * ACCESS DENIED:  unlink:             /usr/lib64/ocaml/llvm/llvm.mli
 * ACCESS DENIED:  fopen_wr:           /usr/lib64/ocaml/llvm/llvm.mli
CMake Error at bindings/ocaml/llvm/cmake_install.cmake:54 (file):
  file INSTALL cannot copy file
  "/var/tmp/portage/dev-lang/julia-1.9.4/work/julia-1.9.4/deps/scratch/llvm-julia-14.0.6-3/build_Release/bindings/ocaml/llvm/llvm.mli"
  to "/usr/lib64/ocaml/llvm/llvm.mli": Permission denied.
Call Stack (most recent call first):
  bindings/ocaml/cmake_install.cmake:47 (include)
  cmake_install.cmake:76 (include)
make[1]: *** [/var/tmp/portage/dev-lang/julia-1.9.4/work/julia-1.9.4/deps/llvm.mk:279: /var/tmp/portage/dev-lang/julia-1.9.4/work/julia-1.9.4/usr-staging/llvm-julia-14.0.6-3/build_Release.tar] Error 1
make[1]: Leaving directory '/var/tmp/portage/dev-lang/julia-1.9.4/work/julia-1.9.4/deps'
make: *** [Makefile:62: julia-deps] Error 2
 * ERROR: dev-lang/julia-1.9.4::gentoo failed (compile phase):
 *   emake failed
 *
 * If you need support, post the output of `emerge --info '=dev-lang/julia-1.9.4::gentoo'`,
 * the complete build log and the output of `emerge -pqv '=dev-lang/julia-1.9.4::gentoo'`.
 * The complete build log is located at '/var/tmp/portage/dev-lang/julia-1.9.4/temp/build.log'.
 * The ebuild environment file is located at '/var/tmp/portage/dev-lang/julia-1.9.4/temp/environment'.
 * Working directory: '/var/tmp/portage/dev-lang/julia-1.9.4/work/julia-1.9.4'
 * S: '/var/tmp/portage/dev-lang/julia-1.9.4/work/julia-1.9.4'
 * ----------------------- SANDBOX ACCESS VIOLATION SUMMARY -----------------------
 * LOG FILE: "/var/tmp/portage/dev-lang/julia-1.9.4/temp/sandbox.log"
 *
#+begin_quote
VERSION 1.0
FORMAT: F - Function called
FORMAT: S - Access Status
FORMAT: P - Path as passed to function
FORMAT: A - Absolute Path (not canonical)
FORMAT: R - Canonical Path
FORMAT: C - Command Line
F: unlink
S: deny
P: /usr/lib64/ocaml/llvm/llvm.mli
A: /usr/lib64/ocaml/llvm/llvm.mli
R: /usr/lib64/ocaml/llvm/llvm.mli
C: cmake -DCMAKE_INSTALL_PREFIX=/var/tmp/portage/dev-lang/julia-1.9.4/work/julia-1.9.4/usr-staging/llvm-julia-14.0.6-3/build_Release/var/tmp/portage/dev-lang/julia-1.9.4/work/julia-1.9.4/usr -P cmake_install.cmake
F: open_wr
S: deny
P: /usr/lib64/ocaml/llvm/llvm.mli
A: /usr/lib64/ocaml/llvm/llvm.mli
R: /usr/lib64/ocaml/llvm/llvm.mli
C: cmake -DCMAKE_INSTALL_PREFIX=/var/tmp/portage/dev-lang/julia-1.9.4/work/julia-1.9.4/usr-staging/llvm-julia-14.0.6-3/build_Release/var/tmp/portage/dev-lang/julia-1.9.4/work/julia-1.9.4/usr -P cmake_install.cmake
F: unlink
S: deny
P: /usr/lib64/ocaml/llvm/llvm.mli
A: /usr/lib64/ocaml/llvm/llvm.mli
R: /usr/lib64/ocaml/llvm/llvm.mli
C: cmake -DCMAKE_INSTALL_PREFIX=/var/tmp/portage/dev-lang/julia-1.9.4/work/julia-1.9.4/usr-staging/llvm-julia-14.0.6-3/build_Release/var/tmp/portage/dev-lang/julia-1.9.4/work/julia-1.9.4/usr -P cmake_install.cmake
F: fopen_wr
S: deny
P: /usr/lib64/ocaml/llvm/llvm.mli
A: /usr/lib64/ocaml/llvm/llvm.mli
R: /usr/lib64/ocaml/llvm/llvm.mli
C: cmake -DCMAKE_INSTALL_PREFIX=/var/tmp/portage/dev-lang/julia-1.9.4/work/julia-1.9.4/usr-staging/llvm-julia-14.0.6-3/build_Release/var/tmp/portage/dev-lang/julia-1.9.4/work/julia-1.9.4/usr -P cmake_install.cmake
#+end_quote
2. Hack: faire "make" dans /var/tmp/portage/dev-lang/julia-1.9.4/work/julia-1.9.4
Installation openblas
make clean
Problème avec cette approche, ne trouve pas la librairie dans usr/lib64 (car elle est dans usr/lib)
#+begin_quote
Warning: git information unavailable; versioning information limited
 cd /var/tmp/portage/dev-lang/julia-1.9.4/work/julia-1.9.4/base && if ! JULIA_BINDIR=/var/tmp/portage/dev-lang/julia-1.9.4/work/julia-1.9.4/usr/bin WINEPATH="/var/tmp/portage/dev-lang/julia-1.9.4/work/julia-1.9.4/usr/bin;$WINEPATH" JULIA_NUM_THREADS=1  /var/tmp/portage/dev-lang/julia-1.9.4/work/julia-1.9.4/usr/bin/julia -O3 -C "native" --output-o /var/tmp/portage/dev-lang/julia-1.9.4/work/julia-1.9.4/usr/lib/julia/sys-o.a.tmp  --startup-file=no --warn-overwrite=yes --sysimage /var/tmp/portage/dev-lang/julia-1.9.4/work/julia-1.9.4/usr/lib/julia/sys.ji /var/tmp/portage/dev-lang/julia-1.9.4/work/julia-1.9.4/contrib/generate_precompile.jl 1; then echo '*** This error is usually fixed by running `make clean`. If the error persists, try `make cleanall`. ***'; false; fi
lld: error: unable to find library -ljulia
lld: error: unable to find library -ljulia-internal
ERROR: failed process: Process(setenv(`/var/tmp/portage/dev-lang/julia-1.9.4/work/julia-1.9.4/usr/tools/lld -flavor gnu '' -shared -o /tmp/jl_EWdHAb/compiled/v1.9/jl_qcZsaH --whole-archive /tmp/jl_EWdHAb/compiled/v1.9/jl_nU44gE --no-whole-archive -L/var/tmp/portage/dev-lang/julia-1.9.4/work/julia-1.9.4/usr/lib64 -L/var/tmp/portage/dev-lang/julia-1.9.4/work/julia-1.9.4/usr/lib64/julia -L/var/tmp/portage/dev-lang/julia-1.9.4/work/julia-1.9.4/usr/lib64 -ljulia -ljulia-internal`,["MFLAGS=", "PATH=/var/tmp/portage/dev-lang/julia-1.9.4/work/julia-1.9.4/usr/tools:/bin:/sbin:/usr/bin:/usr/sbin:/usr/local/bin:/usr/local/sbin", "MAKELEVEL=2", "PWD=/var/tmp/portage/dev-lang/julia-1.9.4/work/julia-1.9.4/base", "DISPLAY=:0", "BUILDROOT=/var/tmp/portage/dev-lang/julia-1.9.4/work/julia-1.9.4", "PKG_CONFIG_LIBDIR=/var/tmp/portage/dev-lang/julia-1.9.4/work/julia-1.9.4/usr/lib/pkgconfig", "MAKEFLAGS=", "SHELL=/bin/bash", "LC_ALL=C"  …  "_=/var/tmp/portage/dev-lang/julia-1.9.4/work/julia-1.9.4/usr/bin/julia", "OPENBLAS_DEFAULT_NUM_THREADS=1", "MAKE_TERMERR=/dev/pts/5", "MAKE_TERMOUT=/dev/pts/5", "USER=root", "HOME=/root", "TERM=tmux-256color", "JULIA_NUM_THREADS=1", "LS_COLORS=rs=0:di=01;34:ln=01;36:mh=00:pi=40;33:so=01;35:do=01;35:bd=40;33;01:cd=40;33;01:or=01;05;37;41:mi=01;05;37;41:su=37;41:sg=30;43:ca=00:tw=30;42:ow=34;42:st=37;44:ex=01;32:*.tar=01;31:*.tgz=01;31:*.arc=01;31:*.arj=01;31:*.taz=01;31:*.lha=01;31:*.lz4=01;31:*.lzh=01;31:*.lzma=01;31:*.tlz=01;31:*.txz=01;31:*.tzo=01;31:*.t7z=01;31:*.zip=01;31:*.z=01;31:*.dz=01;31:*.gz=01;31:*.lrz=01;31:*.lz=01;31:*.lzo=01;31:*.xz=01;31:*.zst=01;31:*.tzst=01;31:*.bz2=01;31:*.bz=01;31:*.tbz=01;31:*.tbz2=01;31:*.tz=01;31:*.deb=01;31:*.rpm=01;31:*.jar=01;31:*.war=01;31:*.ear=01;31:*.sar=01;31:*.rar=01;31:*.alz=01;31:*.ace=01;31:*.zoo=01;31:*.cpio=01;31:*.7z=01;31:*.rz=01;31:*.cab=01;31:*.wim=01;31:*.swm=01;31:*.dwm=01;31:*.esd=01;31:*.avif=01;35:*.jpg=01;35:*.jpeg=01;35:*.mjpg=01;35:*.mjpeg=01;35:*.gif=01;35:*.bmp=01;35:*.pbm=01;35:*.pgm=01;35:*.ppm=01;35:*.tga=01;35:*.xbm=01;35:*.xpm=01;35:*.tif=01;35:*.tiff=01;35:*.png=01;35:*.svg=01;35:*.svgz=01;35:*.mng=01;35:*.pcx=01;35:*.mov=01;35:*.mpg=01;35:*.mpeg=01;35:*.m2v=01;35:*.mkv=01;35:*.webm=01;35:*.webp=01;35:*.ogm=01;35:*.mp4=01;35:*.m4v=01;35:*.mp4v=01;35:*.vob=01;35:*.qt=01;35:*.nuv=01;35:*.wmv=01;35:*.asf=01;35:*.rm=01;35:*.rmvb=01;35:*.flc=01;35:*.avi=01;35:*.fli=01;35:*.flv=01;35:*.gl=01;35:*.dl=01;35:*.xcf=01;35:*.xwd=01;35:*.yuv=01;35:*.cgm=01;35:*.emf=01;35:*.ogv=01;35:*.ogx=01;35:*.cfg=00;32:*.conf=00;32:*.diff=00;32:*.doc=00;32:*.ini=00;32:*.log=00;32:*.patch=00;32:*.pdf=00;32:*.ps=00;32:*.tex=00;32:*.txt=00;32:*.aac=00;36:*.au=00;36:*.flac=00;36:*.m4a=00;36:*.mid=00;36:*.midi=00;36:*.mka=00;36:*.mp3=00;36:*.mpc=00;36:*.ogg=00;36:*.ra=00;36:*.wav=00;36:*.oga=00;36:*.opus=00;36:*.spx=00;36:*.xspf=00;36:*~=00;90:*#=00;90:*.bak=00;90:*.old=00;90:*.orig=00;90:*.part=00;90:*.rej=00;90:*.swp=00;90:*.tmp=00;90:*.dpkg-dist=00;90:*.dpkg-old=00;90:*.ucf-dist=00;90:*.ucf-new=00;90:*.ucf-old=00;90:*.rpmnew=00;90:*.rpmorig=00;90:*.rpmsave=00;90:", "OPENBLAS_MAIN_FREE=1"]), ProcessExited(1)) [1]
#+end_quote
On fait donc un symlink
cd usr && ln -s lib lib64

Replacement in projects/bisonex.org at line 2 [17.35]

B:BD[16.8377] → [16.8377:16569]

B:BD[16.16569] → [3.251:8443]

1.90×
Kit acessible ?
**** TODO Run selon [cite:@Kumaran_2019]
NA12878 SRR098401
NA24385 SRR2962669
NA24631 SRR2962693
**** Résumé
Kit disponible en hg38
| HiSeq 4000   | Agilent SureSelect v7 | SRX11061486 | https://github.com/kevinblighe/agilent |
| NovaSeq 6000 | Agilent SureSelect v7 | SRX11061516 | idem                                   |
Kit disponible en hg19
| HiSeq2000 |  SeqCap EZ Human Exome Lib v3.0 | SRR1611178 |http://hgdownload.soe.ucsc.edu/gbdb/hg19/exomeProbesets/
| HiSeq2000 |  SeqCap EZ Human Exome Lib v3.0 | SRR1611179 |idem
| HiSeq2500 |  SeqCap EZ Human Exome Lib v3.0 | SRR1611183 |idem
| HiSeq2500 |  SeqCap EZ Human Exome Lib v3.0 | SRR1611184 |idem
https://emea.support.illumina.com/downloads/truseq-exome-product-files.html
*** Autres
**** Selon [cite:@Kumaran_2019]
NA24385 SRR2962669
NA24631 SRR2962693
*** Liste de capture
Agilent sureselect v7 hg19 et 38 https://github.com/kevinblighe/agilent
**** UCSCS
- [[http://hgdownload.soe.ucsc.edu/gbdb/hg19/exomeProbesets/][hg19]]
- [[http://hgdownload.soe.ucsc.edu/gbdb/hg38/exomeProbesets/][hg38]]
**** github aztrazeneca
https://github.com/AstraZeneca-NGS/reference_data
- IDT xGen Exome Research Panel v1.0
- Agilent SureSelect Human All Exon V6
- Agilent SureSelect Clinical Research Exome
- Nimblegen SeqCap EZ MedExome
- Nmblegen SeqCap EZ Exome v3
**** Trueseq
https://emea.support.illumina.com/downloads/truseq-exome-product-files.html
*** Exemple de validation avec bcbio:
Télécharge données + bed + liftover avec crossmap
https://github.com/bcbio/bcbio_validation_workflows/blob/master/giab-exome/input/get_data.sh
*** TODO Comment télécharger
**** DONE Tester ligne de commande
CLOSED: [2023-11-29 Wed 23:37] SCHEDULED: <2023-11-28 Tue>
***** KILL Tester aws
CLOSED: [2023-11-28 Tue 23:47] SCHEDULED: <2023-11-28 Tue>
Semble télécharger le .sra vu la taille (manque l'extension)
#+begin_src
aws s3 cp s3://sra-pub-run-odp/sra/SRR1611178/SRR1611178 --no-sign-request .
#+end_src
***** KILL Tester sra faster dump
CLOSED: [2023-11-29 Wed 22:20] SCHEDULED: <2023-11-28 Tue>
Selon la doc https://github.com/ncbi/sra-tools/wiki/08.-prefetch-and-fasterq-dump, il faut faire un "pré" - téléchargement
#+begin_src sh
prefetch  SRR1611178
fastqer-dump  SRR1611178
#+end_src
Note fasterq-dump créé un répertoire temporaire de la taille de prefetch et le supprime. Les fastq ne sont pas compressés
***** DONE Passer par ENA qui donne un lien vers FTP directement
CLOSED: [2023-11-29 Wed 23:37]
**** KILL Nextflow
CLOSED: [2023-12-04 Mon 23:46]
***** KILL fromSRA
CLOSED: [2023-11-29 Wed 23:15]
Ne renvoie pas le FTP pour SRR1611178/SRR1611178 même avec clé API
**** TODO DataToolkit.jl
SCHEDULED: <2023-11-28 Tue>
- plusieurs datasets par patient appelé NA12878 par exemple mais avec attributs différents (séquencer, kit, pair1, pair2)
- FTP depuis ENA (FTP)
- "meta"-dataset for the 2 fastq. Ex:
  #+begin_src toml
[[data1]]
uuid = "4ac8e6a5-9430-4745-8027-551fa620c2a8"
description = "1"
    [[data1.storage]]
    driver = "filesystem"
    checksum = "crc32c:96646914"
    path = "1.txt"
    [[data1.loader]]
    driver = "io->file"
    path = "lol.txt"
[[sequence]]
uuid = "adbaa0af-71fc-43f1-aa5d-408e9c2dc5be"
    [[sequence.storage]]
    driver = "raw"
    value = { forward = "📇DATASET<<data1::DataToolkitBase.FilePath>>"}
    [[sequence.loader]]
    driver = "passthrough"
  #+end_src
*** Zone de capture GIAB fourni le .bed pour l'exome . INfo : https://support.illumina.com/sequencing/sequencing_kits/nextera-rapid-capture-exome-kit/downloads.html
*** Valider la méthode
- 1000 genomes + SureSelect human all exon v2 target capture kit : non disponible sur le site d'agilent (V6 ou plus)
  https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-019-2928-9
- GIAB + liftover du fichire de capture en hg38
Ce qui est aussi fait par
https://bcbio-nextgen.readthedocs.io/en/stable/contents/germline_variants.html
Mais avec UCSC liftover
** Centogène
https://www.twistbioscience.com/node/23906
Bed non fourni pour exactement cette capture
On prend https://www.twistbioscience.com/resources/data-files/twist-alliance-vcgs-exome-401mb-bed-files
qui content la majeure partie
* Réunion
** <2023-08-10 Thu> Alexis
Ok pour bloquer le développment d'ici mardi prochain
Dév:
- pipeline jusque VEP en T2T + GRCh38
- ok pour valider spip T2T sur quelques variant => à intégrer au pipeline
- annotation :
  - ok pour mobidetails hg38
  - +OMIM T2T+ non
  - +franklin hg38+ non pour le moment
- métriques (fastq a minima) + rapport multiqc
- optionnel
  - reformater la sortie
- on abandonne
  - XAMScissors ave indel
  - parallélisation haplotype caller
  - spliceai à la vollée
  - pangolin
Test
- GIAB:
  - hg38: ok pour refaire les tests NA12878 avec données cento, sinon ok pour "c'est difficile" sur les 3 fichiers de capture
  - T2T: ok pour faire des tests rapides mais probablement pas assez de temps !
- patient de synthèse : variant cento confirém par sanger seuls
Résultats
- ok pour scale up bwa mem et haplotyecaller
Manuscrit
- validation de méthode : laisser tomber la version actuelle et faire comme strasbourg (cf ngs diag) dans la présentatino
- a envoyé le powerponit avec les références des différsences articles
- ok pour robo4 si résultat
- architecture cible = VM : 78 coeurs 54Go RAUM et 1To espace disque
Passage en production : ok pour présentation rapide du code
* Nixpkgs :nix:
** DONE GATK
CLOSED: [2023-05-06 Sat 08:51]
*** DONE [[https://github.com/NixOS/nixpkgs/pull/185819][Binaire]]
CLOSED: [2022-09-10 Sat 23:53] SCHEDULED: <2022-08-10 Wed>
/Entered on/ [2022-08-09 Tue 10:57]
PR submitted
*** KILL Corriger code pour utiliser source
CLOSED: [2022-09-11 Sun 22:05]
*** DONE Corriger PATH pour include java et python
CLOSED: [2022-10-11 Tue 11:46]
https://github.com/NixOS/nixpkgs/pull/191548
Review <2022-10-10 Mon> , corrigé dans la journée
*** DONE Update 4.3.0.0
CLOSED: [2023-04-13 Thu 09:01]
** HOLD Nextflow
*** KILL version script seule
CLOSED: [2023-04-01 Sat 18:29]
Fix pour SGE et nextflow
https://github.com/NixOS/nixpkgs/issues/192396
*** KILL Version avec gradle
CLOSED: [2022-10-09 Sun 22:51]
*** HOLD [[https://github.com/NixOS/nixpkgs/issues/192396][Bug report Version 22.10.6]]
**** Notes
Erreur :
ERROR: Cannot download nextflow required file -- make sure you can connect to the internet
Alternatively you can try to download this file:
    https://www.nextflow.io/releases/v22.10.6/nextflow-22.10.6-all.jar
and save it as:
    .//nix/store/md2b1ah4d7ivj82k8xxap30dmdci00pa-nextflow-22.10.6/bin/.nextflow-wrapped
Dans la mise à jour, il y a la création d'un environnement virtuel qui casse l'exécution de nextflow (besoin de télécharger)
Fix = désactiver
**** KILL Patch NXF_OFFLINE=true
CLOSED: [2023-07-02 Sun 11:02] SCHEDULED: <2023-06-11 Sun>
** WAIT [[https://github.com/NixOS/nixpkgs/pull/249329][Multiqc]]
HG002,sanger-chr20,data/HG002-sanger-inserted-chr20_1.fq.gz,data/HG002-sanger-inserted-chr20_2.fq.gz
** KILL Mutalyzer
CLOSED: [2023-08-16 Wed 19:07] SCHEDULED: <2023-08-13 Sun>
Packaging faisable mais nombreux paquet python
** TODO Variant validator -> hgvs
C'est juste une interface autour d'hgvs mais il faut
- postgresql
- un accès ou télécharger des bases de données
  Dépendences
  s: wcwidth, pyee, pure-eval, ptyprocess, pickleshare, parsley, parse, fake-useragent, executing, backcall, appdirs, zipp, websockets, w3lib, urllib3, traitlets, tqdm, tabulate, sqlparse, soupsieve, six, pygments, psycopg2, prompt-toolkit, pexpect, parso, lxml, idna, humanfriendly, decorator, cython, cssselect, configparser, charset-normalizer, certifi, attrs, requests, pysam, pyquery, matplotlib-inline, jedi, importlib-metadata, coloredlogs, beautifulsoup4, asttokens, yoyo-migrations, stack-data, pyppeteer, bs4, bioutils, requests-html, ipython, biocommons.seqrepo, hgvs
** TODO SPIP :spip:
*** DONE PR upstream
CLOSED: [2023-08-12 Sat 18:23] SCHEDULED: <2023-08-12
 Sat 18:00>
*** DONE Mail R. Lemann :T2T:
CLOSED: [2023-08-12 Sat 18:23] SCHEDULED: <2023-08-12 Sat 18:00>
*** KILL Mise à jour T2T :T2T:
*** WAIT Corriger PR
SCHEDULED: <2023-12-18 Mon>
** TODO VEP :vep:
*** DONE [[https://github.com/NixOS/nixpkgs/pull/185691][BioPerl]]
SCHEDULED: <2022-08-10 Wed>
/Entered on/ [2022-08-09 Tue 10:57]
PR submitted
*** DONE BioDBBBigFile
CLOSED: [2023-11-30 Thu 21:52]
:PROPERTIES:
:ORDERED:  t
:END:
/Entered on/ [2022-08-10 Wed 14:28]
On utilise la dernière version de kent, donc plus de problème.
PRête à être mergé. Rebase faite<2023-07-02 Sun>
**** DONE Version de kent déjà packagée : forcer version  335
CLOSED: [2023-07-02 Sun 11:20]
***** KILL [[https://github.com/NixOS/nixpkgs/pull/206991][Restore building kent 404]]
CLOSED: [2023-05-06 Sat 17:40]
Review faite <2023-03-26 Sun> , atteinte merge]
Relancé <2023-05-06 Sat>
Kent 446 n'a pas ce problème donc PR inutile
***** DONE [[https://github.com/NixOS/nixpkgs/pull/223411][Ajouter les header to package]] (inc folder)
CLOSED: [2023-05-08 Mon 10:18] SCHEDULED: <2023-05-07 Sun>
Review à faire
https://github.com/NixOS/nixpkgs/pull/223411
Corrigé et plus besoin de la PR précédente
***** KILL [[https://github.com/NixOS/nixpkgs/pull/186462][BioDBBBigFile]] avec ces 2 changements
CLOSED: [2023-07-02 Sun 11:20]
**** KILL Version de kent déjà packagée : 404
CLOSED: [2023-03-27 Mon 16:43]
Compile mais les tests de passent pas
**** DONE Modifier selon PR https://github.com/NixOS/nixpkgs/pull/186462
CLOSED: [2023-07-30 Sun 22:01] SCHEDULED: <2023-07-30 Sun 20:00>
:LOGBOOK:
CLOCK: [2023-07-30 Sun 19:13]--[2023-07-30 Sun 20:50] =>  1:37
:END:
Modification nécessaire pour kent :
- plus de patch
- suppression d'une boucle dans postPatch
On supprime aussi NIX_BUILD_TOP
**** DONE Corriger PR biobigfile
CLOSED: [2023-11-30 Thu 21:52] SCHEDULED: <2023-12-05 Tue>
/Entered on/ [2023-10-15 Sun 17:21]
*** DONE [[https://github.com/NixOS/nixpkgs/pull/186459][BioDBHTS]]
CLOSED: [2023-05-06 Sat 08:49] SCHEDULED: <2023-04-15 Sat>
/Entered on/ [2022-08-10 Wed 14:28]
Correction pour review faites <2022-10-10 Mon>
*** DONE [[https://github.com/NixOS/nixpkgs/pull/186464][BioExtAlign]]
CLOSED: [2022-10-22 Sat 12:43] SCHEDULED: <2022-08-10 Wed>
/Entered on/ [2022-08-10 Wed 14:28]
Review <2022-10-10 Mon>, correction dans la journée.
Correction 2e passe, attente
Impossible de faire marcher les tests Car il ne trouve pas le module Bio::Tools::Align, qui est dans un dossier ailleurs dans le dépôt. Même en compilant tout le dépôt, cela ne fonctionne pas... On skip les tests.
*** TODO VEP
SCHEDULED: <2023-12-21 Thu>
** WAIT [[https://github.com/NixOS/nixpkgs/pull/230394][rtg-tools]] :vcfeval:
Soumis
** WAIT Package Spip https://github.com/NixOS/nixpkgs/pull/247476
** TODO Happy :happy:
*** TODO PR python 3 upstream
SCHEDULED: <2023-12-27 Wed>
*** TODO nixpkgs en l'état
SCHEDULED: <2023-12-27 Wed>
** PROJ SpliceAI
** TODO Bamsurgeon
/Entered on/ [2023-05-13 Sat 19:11]
*** TODO Velvet
** TODO PR Picard avec option pour gérer la mémoire
Similaire à
https://github.com/bioconda/bioconda-recipes/blob/master/recipes/picard/picard.sh
* Julia :julia:
** KILL XAM.jl: PR pour modification record :julia:
CLOSED: [2023-05-29 Mon 15:40] SCHEDULED: <2023-05-28 Sun>
/Entered on/ [2023-05-27 Sat 22:39]
** TODO XAMscissors.jl :xamscissors:
Modification de la séquence dans BAM.
*Pas de mise à jour de CIGAR*
On convertit en fastq et on lance le pipeline pour "corriger"
#+begin_src sh
cd /home/alex/code/bisonex/out/63003856/preprocessing/mapped
samtools view 63003856_S135.bam NC_000022.11 -o 63003856_S135_chr22.bam
cd /home/alex/recherche/bisonex/code/BamScissors.jl
cp ~/code/bisonex/out/63003856/preprocessing/mapped/63003856_S135_chr22.bam .
samtools index 63003856_chr22.bam
#+end_src
Le script va modifier le bam, le trier et générer le fastq. !!!
Attention: ne pas oublier l'option -n !!!
#+begin_src sh
time julia --project=.. insertVariant.jl
scp 63003856_S135_chr22_{1,2}.fq.gz meso:/Work/Users/apraga/bisonex/tests/bamscissors/
#+end_src
*** WAIT Implémenter les SNV avec VAF :snv:
Stratégie :
1. calculer la profondeur sur les positions
2. créer un dictionnaire { nom du reads : position dataframe }
3. itérer sur tous les reads et changer ceux marqués
**** DONE VAF = 1
CLOSED: [2023-05-29 Mon 15:34]
**** DONE VAF selon loi normale
CLOSED: [2023-05-29 Mon 15:35]
Tronquée si > 1
**** WAIT Tests unitaires
***** DONE NA12878: 1 gène sur chromosome 22
CLOSED: [2023-05-30 Tue 23:55]
root = "https://ftp-trace.ncbi.nlm.nih.gov/ReferenceSamples/giab/data/NA12878/Garvan_NA12878_HG001_HiSeq_Exome/"
#+begin_src sh
samtools view project.NIST_NIST7035_H7AP8ADXX_NA12878.bwa.markDuplicates.bam  chr22 -o project.NIST_NIST7035_H7AP8ADXX_NA12878_chr22.bam
samtools view project.NIST_NIST7035_H7AP8ADXX_NA12878_chr22.bam chr22:19419700-19424000 -o NIST7035_H7AP8ADXX_NA12878_chr22_MRPL40_hg19.bam
#+end_src
***** WAIT Pull request formatspeciment
https://github.com/BioJulia/FormatSpecimens.jl/pull/8
***** DONE Formatspecimens
CLOSED: [2023-05-29 Mon 23:03]
****** DONE 1 read
CLOSED: [2023-05-29 Mon 23:02]
****** DONE VAF sur 1 exon
CLOSED: [2023-05-29 Mon 23:03]
**** DONE [#A] Bug: perte de nombreux reads avec NA12878
CLOSED: [2023-08-19 Sat 20:45] SCHEDULED: <2023-08-18 Fri>
:PROPERTIES:
:ID:       5c1c36f3-f68e-4e6d-a7b6-61dca89abc37
:END:
Ex: chrX:g.124056226 : on passe de 65 reads à 1
Test xamscissors: pas de soucis...
On teste sur cette position +/- 200bp
#+begin_src sh :dir /home/alex/roam/research/bisonex/code/sanger
samtools view   /home/alex/code/bisonex/out/2300346867_NA12878-63118093_S260-GRCh38/preprocessing/mapped/2300346867_NA12878-63118093_S260-GRCh38.bam chrX:124056026-124056426 -o chrXsmall.bam
#+end_src
#+RESULTS:
***** DONE Vérifier profondeur avec dernière version :
CLOSED: [2023-08-19 Sat 20:34] SCHEDULED: <2023-08-19 Sat>
****** DONE chr20: profondeur ok
SCHEDULED: <2023-08-19 Sat>
****** DONE toutes les données
CLOSED: [2023-08-19 Sat 20:34] SCHEDULED: <2023-08-19 Sat>
Ok pour 7 variants (IGV) notament chromosome X
*** TODO Implémenter les indel avec VAF :indel:
*** TODO Soumission paquet
* Données
:PROPERTIES:
:CATEGORY: data
:END:
** DONE Remplacer bam par fastq sur mesocentre
CLOSED: [2023-04-16 Sun 16:33]
Commande
*** DONE Supprimer les fastq non "paired"
CLOSED: [2023-04-16 Sun 16:33]
nushell
Liste des fastq avec "paired-end" manquant
#+begin_src nu
ls **/*.fastq.gz | get name | path basename | split column "_" | get column1 | uniq -u | save single.txt
#+end_src
#+RESULTS:
: 62907927
: 62907970
: 62899606
: 62911287
: 62913201
: 62914084
: 62915905
: 62921595
: 62923065
: 62925220
: 62926503
: 62926502
: 62926500
: 62926499
: 62926498
: 62931719
: 62943423
: 62943400
: 62948290
: 62949205
: 62949206
: 62949118
: 62951284
: 62960792
: 62960785
: 62960787
: 62960617
: 62962561
: 62962692
: 62967473
: 62972194
: 62979102
On vérifie
#+begin_src nu
open single.txt  | lines | each {|e| ls $"fastq/*_($in)/*" | get 0  }
open single.txt  | lines | each {|e| ls $"fastq/*_($in)/*" | get 0.name }  | path basename | split column "_" | get column1 | uniq -c
#+end_src
On met tous dans un dossier (pas de suppression )
#+begin_src
open single.txt  | lines | each {|e| ls $"fastq/*_($in)/*" | get 0  }  | each {|e| ^mv $e.name bad-fastq/}
#+end_src
On vérifie que les dossiier sont videsj
 open single.txt  | lines | each {|e| ls $"fastq/*_($in)" | get 0.name } | ^ls -l $in
 Puis on supprime
 open single.txt  | lines | each {|e| ls $"fastq/*_($in)" | get 0.name } | ^rm -r $in
*** DONE Supprimer bam qui ont des fastq
CLOSED: [2023-04-16 Sun 16:33]
On liste les identifiants des fastq et bam dans un tableau avec leur type :
#+begin_src
let fastq = (ls fastq/*/*.fastq.gz | get name | parse "{dir}/{full_id}/{id}_{R}_001.fastq.gz"  | select dir id | uniq )
let bam = (ls bam/*/*.bam | get name | parse "{dir}/{full_id}/{id}_{S}.bqrt.bam"  | select dir id

[16.8377]

[18.7777]

1.90×
Kit acessible ?
**** TODO Run selon [cite:@Kumaran_2019]
NA12878 SRR098401
NA24385 SRR2962669
NA24631 SRR2962693
**** Résumé
Kit disponible en hg38
| HiSeq 4000   | Agilent SureSelect v7 | SRX11061486 | https://github.com/kevinblighe/agilent |
| NovaSeq 6000 | Agilent SureSelect v7 | SRX11061516 | idem                                   |
Kit disponible en hg19
| HiSeq2000 |  SeqCap EZ Human Exome Lib v3.0 | SRR1611178 |http://hgdownload.soe.ucsc.edu/gbdb/hg19/exomeProbesets/
| HiSeq2000 |  SeqCap EZ Human Exome Lib v3.0 | SRR1611179 |idem
| HiSeq2500 |  SeqCap EZ Human Exome Lib v3.0 | SRR1611183 |idem
| HiSeq2500 |  SeqCap EZ Human Exome Lib v3.0 | SRR1611184 |idem
https://emea.support.illumina.com/downloads/truseq-exome-product-files.html
*** Autres
**** Selon [cite:@Kumaran_2019]
NA24385 SRR2962669
NA24631 SRR2962693
*** Liste de capture
Agilent sureselect v7 hg19 et 38 https://github.com/kevinblighe/agilent
**** UCSCS
- [[http://hgdownload.soe.ucsc.edu/gbdb/hg19/exomeProbesets/][hg19]]
- [[http://hgdownload.soe.ucsc.edu/gbdb/hg38/exomeProbesets/][hg38]]
**** github aztrazeneca
https://github.com/AstraZeneca-NGS/reference_data
- IDT xGen Exome Research Panel v1.0
- Agilent SureSelect Human All Exon V6
- Agilent SureSelect Clinical Research Exome
- Nimblegen SeqCap EZ MedExome
- Nmblegen SeqCap EZ Exome v3
**** Trueseq
https://emea.support.illumina.com/downloads/truseq-exome-product-files.html
*** Exemple de validation avec bcbio:
Télécharge données + bed + liftover avec crossmap
https://github.com/bcbio/bcbio_validation_workflows/blob/master/giab-exome/input/get_data.sh
*** TODO Comment télécharger
**** DONE Tester ligne de commande
CLOSED: [2023-11-29 Wed 23:37] SCHEDULED: <2023-11-28 Tue>
***** KILL Tester aws
CLOSED: [2023-11-28 Tue 23:47] SCHEDULED: <2023-11-28 Tue>
Semble télécharger le .sra vu la taille (manque l'extension)
#+begin_src
aws s3 cp s3://sra-pub-run-odp/sra/SRR1611178/SRR1611178 --no-sign-request .
#+end_src
***** KILL Tester sra faster dump
CLOSED: [2023-11-29 Wed 22:20] SCHEDULED: <2023-11-28 Tue>
Selon la doc https://github.com/ncbi/sra-tools/wiki/08.-prefetch-and-fasterq-dump, il faut faire un "pré" - téléchargement
#+begin_src sh
prefetch  SRR1611178
fastqer-dump  SRR1611178
#+end_src
Note fasterq-dump créé un répertoire temporaire de la taille de prefetch et le supprime. Les fastq ne sont pas compressés
***** DONE Passer par ENA qui donne un lien vers FTP directement
CLOSED: [2023-11-29 Wed 23:37]
**** KILL Nextflow
CLOSED: [2023-12-04 Mon 23:46]
***** KILL fromSRA
CLOSED: [2023-11-29 Wed 23:15]
Ne renvoie pas le FTP pour SRR1611178/SRR1611178 même avec clé API
**** TODO DataToolkit.jl
SCHEDULED: <2023-11-28 Tue>
- plusieurs datasets par patient appelé NA12878 par exemple mais avec attributs différents (séquencer, kit, pair1, pair2)
- FTP depuis ENA (FTP)
- "meta"-dataset for the 2 fastq. Ex:
  #+begin_src toml
[[data1]]
uuid = "4ac8e6a5-9430-4745-8027-551fa620c2a8"
description = "1"
    [[data1.storage]]
    driver = "filesystem"
    checksum = "crc32c:96646914"
    path = "1.txt"
    [[data1.loader]]
    driver = "io->file"
    path = "lol.txt"
[[sequence]]
uuid = "adbaa0af-71fc-43f1-aa5d-408e9c2dc5be"
    [[sequence.storage]]
    driver = "raw"
    value = { forward = "📇DATASET<<data1::DataToolkitBase.FilePath>>"}
    [[sequence.loader]]
    driver = "passthrough"
  #+end_src
*** Zone de capture GIAB fourni le .bed pour l'exome . INfo : https://support.illumina.com/sequencing/sequencing_kits/nextera-rapid-capture-exome-kit/downloads.html
*** Valider la méthode
- 1000 genomes + SureSelect human all exon v2 target capture kit : non disponible sur le site d'agilent (V6 ou plus)
  https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-019-2928-9
- GIAB + liftover du fichire de capture en hg38
Ce qui est aussi fait par
https://bcbio-nextgen.readthedocs.io/en/stable/contents/germline_variants.html
Mais avec UCSC liftover
** Centogène
https://www.twistbioscience.com/node/23906
Bed non fourni pour exactement cette capture
On prend https://www.twistbioscience.com/resources/data-files/twist-alliance-vcgs-exome-401mb-bed-files
qui content la majeure partie
* Réunion
** <2023-08-10 Thu> Alexis
Ok pour bloquer le développment d'ici mardi prochain
Dév:
- pipeline jusque VEP en T2T + GRCh38
- ok pour valider spip T2T sur quelques variant => à intégrer au pipeline
- annotation :
  - ok pour mobidetails hg38
  - +OMIM T2T+ non
  - +franklin hg38+ non pour le moment
- métriques (fastq a minima) + rapport multiqc
- optionnel
  - reformater la sortie
- on abandonne
  - XAMScissors ave indel
  - parallélisation haplotype caller
  - spliceai à la vollée
  - pangolin
Test
- GIAB:
  - hg38: ok pour refaire les tests NA12878 avec données cento, sinon ok pour "c'est difficile" sur les 3 fichiers de capture
  - T2T: ok pour faire des tests rapides mais probablement pas assez de temps !
- patient de synthèse : variant cento confirém par sanger seuls
Résultats
- ok pour scale up bwa mem et haplotyecaller
Manuscrit
- validation de méthode : laisser tomber la version actuelle et faire comme strasbourg (cf ngs diag) dans la présentatino
- a envoyé le powerponit avec les références des différsences articles
- ok pour robo4 si résultat
- architecture cible = VM : 78 coeurs 54Go RAUM et 1To espace disque
Passage en production : ok pour présentation rapide du code
* Nixpkgs :nix:
** DONE GATK
CLOSED: [2023-05-06 Sat 08:51]
*** DONE [[https://github.com/NixOS/nixpkgs/pull/185819][Binaire]]
CLOSED: [2022-09-10 Sat 23:53] SCHEDULED: <2022-08-10 Wed>
/Entered on/ [2022-08-09 Tue 10:57]
PR submitted
*** KILL Corriger code pour utiliser source
CLOSED: [2022-09-11 Sun 22:05]
*** DONE Corriger PATH pour include java et python
CLOSED: [2022-10-11 Tue 11:46]
https://github.com/NixOS/nixpkgs/pull/191548
Review <2022-10-10 Mon> , corrigé dans la journée
*** DONE Update 4.3.0.0
CLOSED: [2023-04-13 Thu 09:01]
** HOLD Nextflow
*** KILL version script seule
CLOSED: [2023-04-01 Sat 18:29]
Fix pour SGE et nextflow
https://github.com/NixOS/nixpkgs/issues/192396
*** KILL Version avec gradle
CLOSED: [2022-10-09 Sun 22:51]
*** HOLD [[https://github.com/NixOS/nixpkgs/issues/192396][Bug report Version 22.10.6]]
**** Notes
Erreur :
ERROR: Cannot download nextflow required file -- make sure you can connect to the internet
Alternatively you can try to download this file:
    https://www.nextflow.io/releases/v22.10.6/nextflow-22.10.6-all.jar
and save it as:
    .//nix/store/md2b1ah4d7ivj82k8xxap30dmdci00pa-nextflow-22.10.6/bin/.nextflow-wrapped
Dans la mise à jour, il y a la création d'un environnement virtuel qui casse l'exécution de nextflow (besoin de télécharger)
Fix = désactiver
**** KILL Patch NXF_OFFLINE=true
CLOSED: [2023-07-02 Sun 11:02] SCHEDULED: <2023-06-11 Sun>
** TODO [[https://github.com/NixOS/nixpkgs/pull/249329][Multiqc]]
SCHEDULED: <2023-12-17 Sun>
HG002,sanger-chr20,data/HG002-sanger-inserted-chr20_1.fq.gz,data/HG002-sanger-inserted-chr20_2.fq.gz
** KILL Mutalyzer
CLOSED: [2023-08-16 Wed 19:07] SCHEDULED: <2023-08-13 Sun>
Packaging faisable mais nombreux paquet python
** TODO Variant validator -> hgvs
C'est juste une interface autour d'hgvs mais il faut
- postgresql
- un accès ou télécharger des bases de données
  Dépendences
  s: wcwidth, pyee, pure-eval, ptyprocess, pickleshare, parsley, parse, fake-useragent, executing, backcall, appdirs, zipp, websockets, w3lib, urllib3, traitlets, tqdm, tabulate, sqlparse, soupsieve, six, pygments, psycopg2, prompt-toolkit, pexpect, parso, lxml, idna, humanfriendly, decorator, cython, cssselect, configparser, charset-normalizer, certifi, attrs, requests, pysam, pyquery, matplotlib-inline, jedi, importlib-metadata, coloredlogs, beautifulsoup4, asttokens, yoyo-migrations, stack-data, pyppeteer, bs4, bioutils, requests-html, ipython, biocommons.seqrepo, hgvs
** TODO SPIP :spip:
*** DONE PR upstream
CLOSED: [2023-08-12 Sat 18:23] SCHEDULED: <2023-08-12 Sat 18:00>
*** DONE Mail R. Lemann :T2T:
CLOSED: [2023-08-12 Sat 18:23] SCHEDULED: <2023-08-12 Sat 18:00>
*** KILL Mise à jour T2T :T2T:
*** WAIT Corriger PR
SCHEDULED: <2023-12-18 Mon>
** TODO VEP :vep:
*** DONE [[https://github.com/NixOS/nixpkgs/pull/185691][BioPerl]]
SCHEDULED: <2022-08-10 Wed>
/Entered on/ [2022-08-09 Tue 10:57]
PR submitted
*** DONE BioDBBBigFile
CLOSED: [2023-11-30 Thu 21:52]
:PROPERTIES:
:ORDERED:  t
:END:
/Entered on/ [2022-08-10 Wed 14:28]
On utilise la dernière version de kent, donc plus de problème.
PRête à être mergé. Rebase faite<2023-07-02 Sun>
**** DONE Version de kent déjà packagée : forcer version  335
CLOSED: [2023-07-02 Sun 11:20]
***** KILL [[https://github.com/NixOS/nixpkgs/pull/206991][Restore building kent 404]]
CLOSED: [2023-05-06 Sat 17:40]
Review faite <2023-03-26 Sun> , atteinte merge]
Relancé <2023-05-06 Sat>
Kent 446 n'a pas ce problème donc PR inutile
***** DONE [[https://github.com/NixOS/nixpkgs/pull/223411][Ajouter les header to package]] (inc folder)
CLOSED: [2023-05-08 Mon 10:18] SCHEDULED: <2023-05-07 Sun>
Review à faire
https://github.com/NixOS/nixpkgs/pull/223411
Corrigé et plus besoin de la PR précédente
***** KILL [[https://github.com/NixOS/nixpkgs/pull/186462][BioDBBBigFile]] avec ces 2 changements
CLOSED: [2023-07-02 Sun 11:20]
**** KILL Version de kent déjà packagée : 404
CLOSED: [2023-03-27 Mon 16:43]
Compile mais les tests de passent pas
**** DONE Modifier selon PR https://github.com/NixOS/nixpkgs/pull/186462
CLOSED: [2023-07-30 Sun 22:01] SCHEDULED: <2023-07-30 Sun 20:00>
:LOGBOOK:
CLOCK: [2023-07-30 Sun 19:13]--[2023-07-30 Sun 20:50] =>  1:37
:END:
Modification nécessaire pour kent :
- plus de patch
- suppression d'une boucle dans postPatch
On supprime aussi NIX_BUILD_TOP
**** DONE Corriger PR biobigfile
CLOSED: [2023-11-30 Thu 21:52] SCHEDULED: <2023-12-05 Tue>
/Entered on/ [2023-10-15 Sun 17:21]
*** DONE [[https://github.com/NixOS/nixpkgs/pull/186459][BioDBHTS]]
CLOSED: [2023-05-06 Sat 08:49] SCHEDULED: <2023-04-15 Sat>
/Entered on/ [2022-08-10 Wed 14:28]
Correction pour review faites <2022-10-10 Mon>
*** DONE [[https://github.com/NixOS/nixpkgs/pull/186464][BioExtAlign]]
CLOSED: [2022-10-22 Sat 12:43] SCHEDULED: <2022-08-10 Wed>
/Entered on/ [2022-08-10 Wed 14:28]
Review <2022-10-10 Mon>, correction dans la journée.
Correction 2e passe, attente
Impossible de faire marcher les tests Car il ne trouve pas le module Bio::Tools::Align, qui est dans un dossier ailleurs dans le dépôt. Même en compilant tout le dépôt, cela ne fonctionne pas... On skip les tests.
*** TODO VEP
SCHEDULED: <2023-12-21 Thu>
** WAIT [[https://github.com/NixOS/nixpkgs/pull/230394][rtg-tools]] :vcfeval:
Soumis
** WAIT Package Spip https://github.com/NixOS/nixpkgs/pull/247476
** TODO Happy :happy:
*** TODO PR python 3 upstream
SCHEDULED: <2023-12-27 Wed>
*** TODO nixpkgs en l'état
SCHEDULED: <2023-12-27 Wed>
** PROJ SpliceAI
** TODO Bamsurgeon
/Entered on/ [2023-05-13 Sat 19:11]
*** TODO Velvet
** TODO PR Picard avec option pour gérer la mémoire
Similaire à
https://github.com/bioconda/bioconda-recipes/blob/master/recipes/picard/picard.sh
** TODO Gatk 4.5.0
SCHEDULED: <2023-12-15 Fri>
/Entered on/ [2023-12-15 Fri 18:58]
* Julia :julia:
** KILL XAM.jl: PR pour modification record :julia:
CLOSED: [2023-05-29 Mon 15:40] SCHEDULED: <2023-05-28 Sun>
/Entered on/ [2023-05-27 Sat 22:39]
** TODO XAMscissors.jl :xamscissors:
Modification de la séquence dans BAM.
*Pas de mise à jour de CIGAR*
On convertit en fastq et on lance le pipeline pour "corriger"
#+begin_src sh
cd /home/alex/code/bisonex/out/63003856/preprocessing/mapped
samtools view 63003856_S135.bam NC_000022.11 -o 63003856_S135_chr22.bam
cd /home/alex/recherche/bisonex/code/BamScissors.jl
cp ~/code/bisonex/out/63003856/preprocessing/mapped/63003856_S135_chr22.bam .
samtools index 63003856_chr22.bam
#+end_src
Le script va modifier le bam, le trier et générer le fastq. !!!
Attention: ne pas oublier l'option -n !!!
#+begin_src sh
time julia --project=.. insertVariant.jl
scp 63003856_S135_chr22_{1,2}.fq.gz meso:/Work/Users/apraga/bisonex/tests/bamscissors/
#+end_src
*** WAIT Implémenter les SNV avec VAF :snv:
Stratégie :
1. calculer la profondeur sur les positions
2. créer un dictionnaire { nom du reads : position dataframe }
3. itérer sur tous les reads et changer ceux marqués
**** DONE VAF = 1
CLOSED: [2023-05-29 Mon 15:34]
**** DONE VAF selon loi normale
CLOSED: [2023-05-29 Mon 15:35]
Tronquée si > 1
**** WAIT Tests unitaires
***** DONE NA12878: 1 gène sur chromosome 22
CLOSED: [2023-05-30 Tue 23:55]
root = "https://ftp-trace.ncbi.nlm.nih.gov/ReferenceSamples/giab/data/NA12878/Garvan_NA12878_HG001_HiSeq_Exome/"
#+begin_src sh
samtools view project.NIST_NIST7035_H7AP8ADXX_NA12878.bwa.markDuplicates.bam  chr22 -o project.NIST_NIST7035_H7AP8ADXX_NA12878_chr22.bam
samtools view project.NIST_NIST7035_H7AP8ADXX_NA12878_chr22.bam chr22:19419700-19424000 -o NIST7035_H7AP8ADXX_NA12878_chr22_MRPL40_hg19.bam
#+end_src
***** WAIT Pull request formatspeciment
https://github.com/BioJulia/FormatSpecimens.jl/pull/8
***** DONE Formatspecimens
CLOSED: [2023-05-29 Mon 23:03]
****** DONE 1 read
CLOSED: [2023-05-29 Mon 23:02]
****** DONE VAF sur 1 exon
CLOSED: [2023-05-29 Mon 23:03]
**** DONE [#A] Bug: perte de nombreux reads avec NA12878
CLOSED: [2023-08-19 Sat 20:45] SCHEDULED: <2023-08-18 Fri>
:PROPERTIES:
:ID:       5c1c36f3-f68e-4e6d-a7b6-61dca89abc37
:END:
Ex: chrX:g.124056226 : on passe de 65 reads à 1
Test xamscissors: pas de soucis...
On teste sur cette position +/- 200bp
#+begin_src sh :dir /home/alex/roam/research/bisonex/code/sanger
samtools view   /home/alex/code/bisonex/out/2300346867_NA12878-63118093_S260-GRCh38/preprocessing/mapped/2300346867_NA12878-63118093_S260-GRCh38.bam chrX:124056026-124056426 -o chrXsmall.bam
#+end_src
#+RESULTS:
***** DONE Vérifier profondeur avec dernière version :
CLOSED: [2023-08-19 Sat 20:34] SCHEDULED: <2023-08-19 Sat>
****** DONE chr20: profondeur ok
SCHEDULED: <2023-08-19 Sat>
****** DONE toutes les données
CLOSED: [2023-08-19 Sat 20:34] SCHEDULED: <2023-08-19 Sat>
Ok pour 7 variants (IGV) notament chromosome X
*** TODO Implémenter les indel avec VAF :indel:
*** TODO Soumission paquet
* Données
:PROPERTIES:
:CATEGORY: data
:END:
** DONE Remplacer bam par fastq sur mesocentre
CLOSED: [2023-04-16 Sun 16:33]
Commande
*** DONE Supprimer les fastq non "paired"
CLOSED: [2023-04-16 Sun 16:33]
nushell
Liste des fastq avec "paired-end" manquant
#+begin_src nu
ls **/*.fastq.gz | get name | path basename | split column "_" | get column1 | uniq -u | save single.txt
#+end_src
#+RESULTS:
: 62907927
: 62907970
: 62899606
: 62911287
: 62913201
: 62914084
: 62915905
: 62921595
: 62923065
: 62925220
: 62926503
: 62926502
: 62926500
: 62926499
: 62926498
: 62931719
: 62943423
: 62943400
: 62948290
: 62949205
: 62949206
: 62949118
: 62951284
: 62960792
: 62960785
: 62960787
: 62960617
: 62962561
: 62962692
: 62967473
: 62972194
: 62979102
On vérifie
#+begin_src nu
open single.txt  | lines | each {|e| ls $"fastq/*_($in)/*" | get 0  }
open single.txt  | lines | each {|e| ls $"fastq/*_($in)/*" | get 0.name }  | path basename | split column "_" | get column1 | uniq -c
#+end_src
On met tous dans un dossier (pas de suppression )
#+begin_src
open single.txt  | lines | each {|e| ls $"fastq/*_($in)/*" | get 0  }  | each {|e| ^mv $e.name bad-fastq/}
#+end_src
On vérifie que les dossiier sont videsj
 open single.txt  | lines | each {|e| ls $"fastq/*_($in)" | get 0.name } | ^ls -l $in
 Puis on supprime
 open single.txt  | lines | each {|e| ls $"fastq/*_($in)" | get 0.name } | ^rm -r $in
*** DONE Supprimer bam qui ont des fastq
CLOSED: [2023-04-16 Sun 16:33]
On liste les identifiants des fastq et bam dans un tableau avec leur type :
#+begin_src
let fastq = (ls fastq/*/*.fastq.gz | get name | parse "{dir}/{full_id}/{id}_{R}_001.fastq.gz"  | select dir id | uniq )
let bam = (ls bam/*/*.bam | get name | parse "{dir}/{full_id}/{id}_{S}.bqrt.bam"  | select dir id

Replacement in projects/bisonex.org at line 63 [17.35]

B:BD[3.24829] → [3.24829:33021]

QUERY.TOTAL.het_hom_ratio
INDEL    ALL          413       246       167          751       289        215      2     98       0.595642          0.460821        0.286285         0.519629                     NaN                     NaN                   2.428571                   2.465116
INDEL   PASS          413       246       167          751       289        215      2     98       0.595642          0.460821        0.286285         0.519629                     NaN                     NaN                   2.428571                   2.465116
  SNP    ALL        15883     15479       404        23597      5277       2841     46     44       0.974564          0.745760        0.120397         0.844947                3.017198                 2.85705                   5.560099                   2.114633
  SNP   PASS        15883     15479       404        23597      5277       2841     46     44       0.974564          0.745760        0.120397         0.844947                3.017198                 2.85705                   5.560099                   2.114633
******* DONE Vérifier qu'il ne reste plus de filtre autre que PASS
CLOSED: [2023-07-08 Sat 15:19]
#+begin_src
$ zgrep -c 'PASS' HG001_GRCh38_1_22_v4_lifted_merged.vcf.gz
3730505
$ zgrep -c '^chr' HG001_GRCh38_1_22_v4_lifted_merged.vcf.gz
3730506
#+end_src
****** TODO 1/4 SNP manquant ?
******* DONE Regarder avec Julia si ce sont vraiment des FP: 61/5277 qui ne le sont pas
CLOSED: [2023-07-09 Sun 12:09]
******* DONE Examiner les FP
CLOSED: [2023-07-30 Sun 22:05]
******* DONE Tester un FP
CLOSED: [2023-07-30 Sun 22:05]
  2 │ chr1        608765  A           G           ./.:.:.:.:NOCALL:nocall:.  1/1:FP:.:ti:SNP:homalt:188
  liftDown UCSC: rien en GIAB : vrai FP
 3 │ chr1        762943  A           G           ./.:.:.:.:NOCALL:nocall:.  1/1:FP:.:ti:SNP:homalt:287
 4 │ chr1        762945  A           T           ./.:.:.:.:NOCALL:nocall:.  1/1:FP:.:tv:SNP:homalt:287
 Remaniements complexes ? Pas dans le gène en HG38
******* DONE La plupart des FP (4705/5566) sont homozygotes: erreur de référence ?
CLOSED: [2023-07-12 Wed 21:10] SCHEDULED: <2023-07-09 Sun>
Sur les 2 premiers variants, ils montrent en fait la différence entre T2T et GRCh38
Erreur à l'alignement ?
******** KILL relancer l'alignement
CLOSED: [2023-07-09 Sun 17:36]
******** DONE vérifier reads identiques hg38 et T2T: oui
CLOSED: [2023-07-09 Sun 16:36]
T2T CHR1608765
38   	chr1:1180168-1180168 (
SRR14724513.24448214
SRR14724513.24448214
******* DONE Vérifier quelques variants sur IGV
CLOSED: [2023-07-09 Sun 17:36]
******* KILL Répartition des FP : cluster ?
CLOSED: [2023-07-09 Sun 17:36]
****** DONE Examiner les FP restant après correction selon séquence de référence
CLOSED: [2023-08-12 Sat 15:57]
****** HOLD Examiner les variants supprimé
****** TODO Enlever les FP qui correspondent à un changement dans le génome
******* Condition:
- pas de variation à la position en GRCh38
- variantion homozygote
- la varation en T2T correspond au changement de pair de base GRC38 -> T2T
  pour les SNP:
  alt_T2T[i] = DNA_GRC38[j]
  avec i la position en T2T et j la position en GRCh38
  Note: définir un ID n'est pas correct car les variants peuvent être modifié par happy !
******* Idée
 - Pour chaque FP, c'est un "faux" FP si
     - REF en hg38 == ALT en T2T
     - et REF en hg38 != REF en T2T
     - et variant homozygote
Comment obtenir les séquences de réferences ?
1. liftover
2. blat sur la séquence autour du variant
3. identifier quelques reads contenant le variant et regarder leur aligneement en hg38
Après discussion avec Alexis: solution 3
******* Algorithme
1. Extraire les coordonnées en T2T des faux positifs *homozygote*
2. Pour chaque faux positif
   1. lister 10 reads contenant le variant
   2. pour chacun de ces reads, récupérer la séquence en T2T et GRCh38 via le nom du read dans le bam
   3. si la séquence en T2T modifiée par le variant est "identique" à celle en GRCh38, alors on ignore ce faux positif
Note: on ignore les reads qui ont changé de chromosome entre les version
******* DONE Résultat préliminaire
CLOSED: [2023-07-23 Sun 14:30]
cf [[file:~/roam/research/bisonex/code/giab/giab-corrected.csv][script julia]]
3498 faux positifs en moins, soit 0.89 sensibilité
julia> tp=15479
julia> fp=5277
julia> tp/(tp+fp)
0.7457602620928888
julia> tp/(tp+(fp-3498))
0.8969173716537258
On est toujours en dessous des 97%
******* HOLD Corriger proprement VCF ou résultats Happy
******* TODO Adapter pour gérer plusieurs variants par read
****** DONE Méthodologie du pangenome
CLOSED: [2023-10-03 Tue 21:28]
Voir biblio[cite:@liao2023]  mais ont aligné sur GRCH38
******* DONE Mail alexis
CLOSED: [2023-10-03 Tue 21:28]
****** DONE Méthodologie T2T
CLOSED: [2023-10-16 Mon 19:42]
Mail alexis
SCHEDULED: <2023-10-04 Wed>
***** TODO Rendre simplement le nombre de vrais positifs
SCHEDULED: <2023-12-18 Mon>
***** KILL Mail Yannis
CLOSED: [2023-07-08 Sat 10:44]
***** DONE Mail GIAB pour version T2T
CLOSED: [2023-07-07 Fri 18:37]
**** KILL HG002 :hg002:T2T:
CLOSED: [2023-11-26 Sun 12:30]
**** KILL HG003 :hg003:T2T:
CLOSED: [2023-11-26 Sun 12:30]
**** KILL HG004 :hg004:T2T:
CLOSED: [2023-11-26 Sun 12:30]
**** DONE Plot : ashkenazim trio :hg38:
CLOSED: [2023-07-30 Sun 16:49] SCHEDULED: <2023-07-30 Sun 15:00>
:LOGBOOK:
CLOCK: [2023-07-30 Sun 16:06]--[2023-07-30 Sun 16:35] =>  0:29
CLOCK: [2023-07-30 Sun 15:39]--[2023-07-30 Sun 15:40] =>  0:01
:END:
/Entered on/ [2023-04-16 Sun 17:29]
Refaire résultats
**** DONE Mail Paul sur les résultat ashkenazim +/- centogene
CLOSED: [2023-08-06 Sun 20:24] SCHEDULED: <2023-08-06 Sun>
**** DONE Relancer comparaison GIAB avec GATK 4.4.0
CLOSED: [2023-08-12 Sat 15:55]
/Entered on/ [2023-08-03 Thu 12:42]
**** TODO Re-télécharger proprement dans pipeline dédiés
[[*Résumé][Résumé]]
Cf [[*Validation : Quelles données de référence ?][Validation : Quelles données de référence ?]]
https://medium.com/dnanexus/benchmarking-state-of-the-art-secondary-variant-calling-pipelines-5472ca6bace7
Source:
https://trace.ncbi.nlm.nih.gov/Traces/index.html?view=study&acc=SRP047086
https://zenodo.org/records/3597727
Selon https://github.com/genome-in-a-bottle/giab_data_indexes
***** TODO HG001 :hg001:
SCHEDULED: <2023-11-29 Wed>
****** TODO Avec données en hg38
SCHEDULED: <2023-11-29 Wed>
[[*Résumé][Résumé]]
Ok pour hiseq4000 et sureselect mais utiliser le dernier commit pour symlink
****** TODO Avec données en hg19
SCHEDULED: <2023-12-20 Wed>
Utiliser crossmap ! https://crossmap.readthedocs.io/en/latest/ (inspiré de [[https://github.com/bcbio/bcbio_validation_workflows/blob/master/giab-exome/input/get_data.sh][bcbio]]
pour vérifier
***** TODO HG002 :hg002:
SCHEDULED: <2023-12-16 Sat>
***** TODO HG003 :hg003:
SCHEDULED: <2023-12-16 Sat>
***** TODO HG004 :hg001:
SCHEDULED: <2023-12-16 Sat>
**** TODO Refaire les analyses happy+ rtgeval
SCHEDULED: <2023-12-09 Sat>
On veut les résultats de https://medium.com/dnanexus/benchmarking-state-of-the-art-secondary-variant-calling-pipelines-5472ca6bace7
hap.py avec conda ?
*** TODO Platinum genome :platinum:
https://emea.illumina.com/platinumgenomes.html
**** TODO Tester sur la zone couverte par l'exome centogène
SCHEDULED: <2023-12-18 Mon>
*** DONE Séquencer NA12878 :cento:hg001:
CLOSED: [2023-10-07 Sat 17:59]
Discussion avec Paul : sous-traitant ne nous donnera pas les données, il faut commander l'ADN
**** DONE ADN commandé
CLOSED: [2023-06-30 Fri 22:29]
**** DONE Sauvegarder les données brutes
CLOSED: [2023-07-30 Sun 14:22] SCHEDULED: <2023-07-19 Wed>
K, scality, S
**** KILL Récupérer le fichier de capture
CLOSED: [2023-07-30 Sun 14:25] SCHEDULED: <2023-07-23 Sun>
Candidats donnés dans publication https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8354858/
#+begin_quote
In short, the Nextera Rapid Capture Exome Kit (Illumina, San Diego, CA), the SureSelect Human All Exon kit (Agilent, Santa Clara, CA) or the Twist Human Core Exome was used for enrichment

[3.24829]

[3.33021]

QUERY.TOTAL.het_hom_ratio
INDEL    ALL          413       246       167          751       289        215      2     98       0.595642          0.460821        0.286285         0.519629                     NaN                     NaN                   2.428571                   2.465116
INDEL   PASS          413       246       167          751       289        215      2     98       0.595642          0.460821        0.286285         0.519629                     NaN                     NaN                   2.428571                   2.465116
  SNP    ALL        15883     15479       404        23597      5277       2841     46     44       0.974564          0.745760        0.120397         0.844947                3.017198                 2.85705                   5.560099                   2.114633
  SNP   PASS        15883     15479       404        23597      5277       2841     46     44       0.974564          0.745760        0.120397         0.844947                3.017198                 2.85705                   5.560099                   2.114633
******* DONE Vérifier qu'il ne reste plus de filtre autre que PASS
CLOSED: [2023-07-08 Sat 15:19]
#+begin_src
$ zgrep -c 'PASS' HG001_GRCh38_1_22_v4_lifted_merged.vcf.gz
3730505
$ zgrep -c '^chr' HG001_GRCh38_1_22_v4_lifted_merged.vcf.gz
3730506
#+end_src
****** TODO 1/4 SNP manquant ?
******* DONE Regarder avec Julia si ce sont vraiment des FP: 61/5277 qui ne le sont pas
CLOSED: [2023-07-09 Sun 12:09]
******* DONE Examiner les FP
CLOSED: [2023-07-30 Sun 22:05]
******* DONE Tester un FP
CLOSED: [2023-07-30 Sun 22:05]
  2 │ chr1        608765  A           G           ./.:.:.:.:NOCALL:nocall:.  1/1:FP:.:ti:SNP:homalt:188
  liftDown UCSC: rien en GIAB : vrai FP
 3 │ chr1        762943  A           G           ./.:.:.:.:NOCALL:nocall:.  1/1:FP:.:ti:SNP:homalt:287
 4 │ chr1        762945  A           T           ./.:.:.:.:NOCALL:nocall:.  1/1:FP:.:tv:SNP:homalt:287
 Remaniements complexes ? Pas dans le gène en HG38
******* DONE La plupart des FP (4705/5566) sont homozygotes: erreur de référence ?
CLOSED: [2023-07-12 Wed 21:10] SCHEDULED: <2023-07-09 Sun>
Sur les 2 premiers variants, ils montrent en fait la différence entre T2T et GRCh38
Erreur à l'alignement ?
******** KILL relancer l'alignement
CLOSED: [2023-07-09 Sun 17:36]
******** DONE vérifier reads identiques hg38 et T2T: oui
CLOSED: [2023-07-09 Sun 16:36]
T2T CHR1608765
38   	chr1:1180168-1180168 (
SRR14724513.24448214
SRR14724513.24448214
******* DONE Vérifier quelques variants sur IGV
CLOSED: [2023-07-09 Sun 17:36]
******* KILL Répartition des FP : cluster ?
CLOSED: [2023-07-09 Sun 17:36]
****** DONE Examiner les FP restant après correction selon séquence de référence
CLOSED: [2023-08-12 Sat 15:57]
****** HOLD Examiner les variants supprimé
****** TODO Enlever les FP qui correspondent à un changement dans le génome
******* Condition:
- pas de variation à la position en GRCh38
- variantion homozygote
- la varation en T2T correspond au changement de pair de base GRC38 -> T2T
  pour les SNP:
  alt_T2T[i] = DNA_GRC38[j]
  avec i la position en T2T et j la position en GRCh38
  Note: définir un ID n'est pas correct car les variants peuvent être modifié par happy !
******* Idée
 - Pour chaque FP, c'est un "faux" FP si
     - REF en hg38 == ALT en T2T
     - et REF en hg38 != REF en T2T
     - et variant homozygote
Comment obtenir les séquences de réferences ?
1. liftover
2. blat sur la séquence autour du variant
3. identifier quelques reads contenant le variant et regarder leur aligneement en hg38
Après discussion avec Alexis: solution 3
******* Algorithme
1. Extraire les coordonnées en T2T des faux positifs *homozygote*
2. Pour chaque faux positif
   1. lister 10 reads contenant le variant
   2. pour chacun de ces reads, récupérer la séquence en T2T et GRCh38 via le nom du read dans le bam
   3. si la séquence en T2T modifiée par le variant est "identique" à celle en GRCh38, alors on ignore ce faux positif
Note: on ignore les reads qui ont changé de chromosome entre les version
******* DONE Résultat préliminaire
CLOSED: [2023-07-23 Sun 14:30]
cf [[file:~/roam/research/bisonex/code/giab/giab-corrected.csv][script julia]]
3498 faux positifs en moins, soit 0.89 sensibilité
julia> tp=15479
julia> fp=5277
julia> tp/(tp+fp)
0.7457602620928888
julia> tp/(tp+(fp-3498))
0.8969173716537258
On est toujours en dessous des 97%
******* HOLD Corriger proprement VCF ou résultats Happy
******* TODO Adapter pour gérer plusieurs variants par read
****** DONE Méthodologie du pangenome
CLOSED: [2023-10-03 Tue 21:28]
Voir biblio[cite:@liao2023]  mais ont aligné sur GRCH38
******* DONE Mail alexis
CLOSED: [2023-10-03 Tue 21:28]
****** DONE Méthodologie T2T
CLOSED: [2023-10-16 Mon 19:42]
Mail alexis
SCHEDULED: <2023-10-04 Wed>
***** TODO Rendre simplement le nombre de vrais positifs
SCHEDULED: <2023-12-18 Mon>
***** KILL Mail Yannis
CLOSED: [2023-07-08 Sat 10:44]
***** DONE Mail GIAB pour version T2T
CLOSED: [2023-07-07 Fri 18:37]
**** KILL HG002 :hg002:T2T:
CLOSED: [2023-11-26 Sun 12:30]
**** KILL HG003 :hg003:T2T:
CLOSED: [2023-11-26 Sun 12:30]
**** KILL HG004 :hg004:T2T:
CLOSED: [2023-11-26 Sun 12:30]
**** DONE Plot : ashkenazim trio :hg38:
CLOSED: [2023-07-30 Sun 16:49] SCHEDULED: <2023-07-30 Sun 15:00>
:LOGBOOK:
CLOCK: [2023-07-30 Sun 16:06]--[2023-07-30 Sun 16:35] =>  0:29
CLOCK: [2023-07-30 Sun 15:39]--[2023-07-30 Sun 15:40] =>  0:01
:END:
/Entered on/ [2023-04-16 Sun 17:29]
Refaire résultats
**** DONE Mail Paul sur les résultat ashkenazim +/- centogene
CLOSED: [2023-08-06 Sun 20:24] SCHEDULED: <2023-08-06 Sun>
**** DONE Relancer comparaison GIAB avec GATK 4.4.0
CLOSED: [2023-08-12 Sat 15:55]
/Entered on/ [2023-08-03 Thu 12:42]
**** TODO Re-télécharger proprement dans pipeline dédiés
[[*Résumé][Résumé]]
Cf [[*Validation : Quelles données de référence ?][Validation : Quelles données de référence ?]]
https://medium.com/dnanexus/benchmarking-state-of-the-art-secondary-variant-calling-pipelines-5472ca6bace7
Source:
https://trace.ncbi.nlm.nih.gov/Traces/index.html?view=study&acc=SRP047086
https://zenodo.org/records/3597727
Selon https://github.com/genome-in-a-bottle/giab_data_indexes
***** TODO HG001 :hg001:
SCHEDULED: <2023-11-29 Wed>
****** TODO Avec données en hg38
SCHEDULED: <2023-11-29 Wed>
[[*Résumé][Résumé]]
Ok pour hiseq4000 et sureselect mais utiliser le dernier commit pour symlink
****** TODO Avec données en hg19
SCHEDULED: <2023-12-20 Wed>
Utiliser crossmap ! https://crossmap.readthedocs.io/en/latest/ (inspiré de [[https://github.com/bcbio/bcbio_validation_workflows/blob/master/giab-exome/input/get_data.sh][bcbio]]
pour vérifier
***** TODO HG002 :hg002:
SCHEDULED: <2023-12-21 Thu>
***** TODO HG003 :hg003:
SCHEDULED: <2023-12-21 Thu>
***** TODO HG004 :hg001:
SCHEDULED: <2023-12-21 Thu>
**** TODO Refaire les analyses happy+ rtgeval
SCHEDULED: <2023-12-09 Sat>
On veut les résultats de https://medium.com/dnanexus/benchmarking-state-of-the-art-secondary-variant-calling-pipelines-5472ca6bace7
hap.py avec conda ?
*** TODO Platinum genome :platinum:
https://emea.illumina.com/platinumgenomes.html
**** TODO Tester sur la zone couverte par l'exome centogène
SCHEDULED: <2023-12-18 Mon>
*** DONE Séquencer NA12878 :cento:hg001:
CLOSED: [2023-10-07 Sat 17:59]
Discussion avec Paul : sous-traitant ne nous donnera pas les données, il faut commander l'ADN
**** DONE ADN commandé
CLOSED: [2023-06-30 Fri 22:29]
**** DONE Sauvegarder les données brutes
CLOSED: [2023-07-30 Sun 14:22] SCHEDULED: <2023-07-19 Wed>
K, scality, S
**** KILL Récupérer le fichier de capture
CLOSED: [2023-07-30 Sun 14:25] SCHEDULED: <2023-07-23 Sun>
Candidats donnés dans publication https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8354858/
#+begin_quote
In short, the Nextera Rapid Capture Exome Kit (Illumina, San Diego, CA), the SureSelect Human All Exon kit (Agilent, Santa Clara, CA) or the Twist Human Core Exome was used for enrichment

Replacement in projects/bisonex.org at line 79 [17.35]

B:BD[3.49406] → [3.49406:56681]

∅:D[13.49832] → [19.39976:40893]

∅:D[3.56681] → [19.39976:40893]

B:BD[19.39976] → [19.39976:40893]

otein_coding" preferred)
    CCDS status of transcript
    consequence rank according to this table
    translated, transcript or feature length (longer preferred)
"Wherever possible we would discourage you from summarising data in this way. "
**** DONE Mail alexis
CLOSED: [2023-08-20 Sun 13:45] SCHEDULED: <2023-08-20 Sun>
**** TODO Données simuscop 200x
SCHEDULED: <2023-12-16 Sat>
**** DONE En T2T avec liftover (filtre = spip) : ok mais lent et trop de variants :tests:
CLOSED: [2023-09-17 Sun 17:13] SCHEDULED: <2023-09-17 Sun>
1. Conversion en bed
#+begin_src sh :dir:~/code/sanger
open snvs-cento-sanger.csv | select chrom pos | insert pos2 {$in.pos } | to csv --separator="\t" | save snvs-cento-sanger.bed -f
#+end_src
2. Liftover avec UCSC (en ligne)
NB: vérifié sur le premier résultat en cherche le read contenant le variant (samtools view -r puis samtools view | grep en T2T) et avec l'aide d'IGV, on a un variant qui correspond en
chr1:10757746
3. En supposant que l'ordre des variants n'a pas changé, on ajoute simplement REF et ALT avec annotateLifted.jl
Annotation spip *très lente* : 1h13 !
Résultat:
2×3 DataFrame
 Row │ variant              meanQual  depth
     │ String               Float64   Int64
─────┼──────────────────────────────────────
   1 │ chr12:g.13594572      60.0      1
   2 │ chr17:g.10204026      60.0      1
144 found over 146
filter depth : another 0 missed variants
filter poly : another 0 missed variants
filter vep   : another 0 missed variants
Et on a trop de variants en sortie (7330 !)
**** DONE Mail Paul avec résultats filtre en T2T + nouveau schéma
CLOSED: [2023-09-17 Sun 23:15] SCHEDULED: <2023-09-17 Sun>
** TODO Medically relevant genes
SCHEDULED: <2023-12-18 Mon>
/Entered on/ [2023-10-18 Wed 22:37]
** TODO HG002 en T2T
/Entered on/ [2023-11-25 Sat 17:58]
https://github.com/marbl/HG002
*** TODO Tester les benchmark préliminaires
SCHEDULED: <2023-12-26 Tue>
https://ftp-trace.ncbi.nlm.nih.gov/ReferenceSamples/giab/data/AshkenazimTrio/analysis/NIST_HG002_DraftBenchmark_defrabbV0.011-20230725/
* Ré-interprétation :reanalysis:
** DONE Lancer tests sur données brutes [225/250] <(samples.csv)>  <(runs.waiting)>
CLOSED: [2023-10-14 Sat 11:58] SCHEDULED: <2023-10-08 Sun>
- [X] 100222_63015289
- [X] 1600304839_63051311
- [X] 1900007827_62913191
- [X] 1900398899_62999500
- [X] 1900486799_62913197
- [X] 2100422923_62952677
- [X] 2100458888_62933047
- [X] 2100601558_62903840
- [X] 2100609288_62905768
- [X] 2100609501_62905776
- [X] 2100614493_62951074
- [X] 2100622566_62908067
- [X] 2100622601_62908060
- [X] 2100622705_62908063
- [X] 2100640027_62911936
- [X] 2100645285_62913212
- [X] 2100661411_62914081
- [X] 2100661462_62914086
- [X] 2100708257_62921596
- [X] 2100738732_62926501
- [X] 2100738850_62926509
- [X] 2100746751_62926505
- [X] 2100746797_62926506
- [X] 2100782349_62931722
- [X] 2100782416_62931561
- [X] 2100782559_62931718
- [X] 2100799204_62934768
- [X] 2200010202_62940284
- [X] 2200023600_62940631
- [X] 2200024348_62999591
- [X] 2200027505_62942457
- [X] 2200038776_62943412
- [X] 2200041919_62943405
- [X] 2200088014_62951326
- [X] 2200146652_62959388
- [X] 2200151850_62960953
- [X] 2200160014_62959475
- [X] 2200160070_62959478
- [X] 2200201368_62967471
- [X] 2200201400_62967470
- [X] 2200265558_62976332
- [X] 2200265605_62976401
- [X] 2200267046_62975192
- [X] 2200273878_62999530
- [X] 2200279708_62977002
- [X] 2200284408_62979102
- [X] 2200293987_62979116
- [X] 2200294359_62979118
- [X] 2200306299_62982217
- [X] 2200306539_62982193
- [X] 220030671_62982211
- [X] 2200307058_62982231
- [X] 2200307108_62982196
- [X] 2200307136_62982221
- [X] 2200307199_62982239
- [X] 2200307230_62982234
- [X] 2200307262_62982219
- [X] 2200307297_62982227
- [X] 2200324510_62985453
- [X] 2200324549_62985478
- [X] 2200324573_62985445
- [X] 2200324594_62985467
- [X] 2200324606_62985463
- [X] 2200324614_62985459
- [X] 2200338306_62985430
- [X] 2200343880_62989407
- [X] 2200343910_62989460
- [X] 2200343938_62989451
- [X] 2200343966_62989456
- [X] 2200343993_62989440
- [X] 2200344013_62989464
- [X] 2200349749_62989465
- [X] 2200363462_62988848
- [X] 2200377880_62991993
- [X] 2200378032_62991991
- [X] 2200383996_62993828
- [X] 2200384015_62993796
- [X] 2200384046_62993822
- [X] 2200384117_62993808
- [X] 2200384187_62993825
- [X] 2200384231_62992898
- [X] 2200385658_63060260
- [X] 2200394260_62994732
- [X] 2200395817_62994742
- [X] 2200396731_62994737
- [X] 2200424073_62999579
- [X] 2200424207_62999632
- [X] 2200426178_62999630
- [X] 2200426243_62999635
- [X] 2200426466_62999605
- [X] 2200426642_62999627
- [X] 2200427406_62999649
- [X] 2200427512_62999639
- [X] 2200428953_62999572
- [X] 2200428981_62999600
- [X] 2200428999_62999592
- [X] 2200441970_63000868
- [X] 2200441989_63000882
- [X] 2200442135_63000864
- [X] 2200442216_63000886
- [X] 2200442257_63000951
- [X] 2200451801_63003573
- [X] 2200451862_63004218
- [X] 2200451894_63004210
- [X] 2200456165_63051294
- [X] 2200459865_63004933
- [X] 2200459968_63004937
- [X] 2200460073_63004943
- [X] 2200460121_63004684
- [X] 2200467051_63003856
- [X] 2200467225_63004940
- [X] 2200467261_63004930
- [X] 2200467338_63004925
- [X] 2200470099_63004485
- [X] 2200470142_63004480
- [X] 2200471780_63004362
- [X] 2200480910_63006466
- [X] 2200495073_63010427
- [X] 2200495510_63009152
- [X] 2200508677_63060252
- [X] 2200510531_63012582
- [X] 2200510628_63012549
- [X] 2200510657_63012554
- [X] 2200511249_63012533
- [X] 2200511274_63012586
- [X] 2200517952_63060399
- [X] 2200519525_63060439
- [X] 2200524009_63014044
- [X] 2200524609_63014046
- [X] 2200524616_63014048
- [X] 2200533429_63060425
- [X] 2200539735_63060406
- [X] 2200549908_63019339
- [X] 2200549965_63019349
- [X] 2200550414_63019357
- [X] 2200550471_63020031
- [X] 2200550490_63019351
- [X] 2200550505_63019340
- [X] 2200555565_63018614
- [X] 2200559438_63020029
- [X] 2200559682_63020030
- [X] 2200559713_63019623
- [X] 2200559739_63019626
- [X] 2200569969_63019991
- [X] 2200570001_63021580
- [X] 2200570025_63021490
- [X] 2200570035_63021491
- [X] 2200570042_63021493
- [X] 2200570050_63021494
- [X] 2200579897_63024910
- [X] 2200583995_63024866
- [X] 2200584035_63024905
- [X] 2200584069_63024888
- [X] 2200584126_63024810
- [X] 2200589507_63026712
- [X] 2200597365_63027994
- [X] 2200597480_63027988
- [X] 2200597752_63026853
- [X] 2200597778_63027992
- [X] 22005977_63026903
- [X] 2200609031_63026527
- [X] 2200614198_63113928
- [X] 2200620372_63030821
- [X] 2200620442_63030810
- [X] 2200620498_63030816
- [X] 2200620628_63031031
- [X] 2200622310_63030984
- [X] 2200622355_63030956
- [X] 2200625369_63028699
- [X] 2200625410_63028697
- [X] 2200625536_63028694
- [X] 2200630189_63030665
- [X] 2200635149_63033182
- [X] 2200644544_63037731
- [X] 2200644594_63037725
- [X] 2200650089_63038093
- [X] 2200666292_63076568
- [X] 2200669188_63036688
- [X] 2200669320_63040259
- [X] 2200669383_63040254
- [X] 2200669414_63040257
- 
[X] 2200669446_63040251
- [X] 2200680342_63105271
- [X] 2200694535_63042853
- [X] 2200694789_63042862
- [X] 2200694858_63042702
- [X] 2200694917_63042696
- [X] 2200699290_63043047
- [X] 2200699345_63040238
- [X] 2200699383_63043050
- [X] 2200699412_63040731
- [X] 220071551_63048935
- [X] 2200731515_63048963
- [X] 2200748145_63051198
- [X] 2200748171_63051213
- [X] 2200751046_63051249
- [X] 2200751101_63051234
- [X] 2200766471_63054590
- [X] 2200767731_63054595
- [X] 2200767822_63054464
- [X] 2200775505_63060410
- [X] 2200850441_63019345
- [X] 220597589_63026879
- [X] 2300003253_63060430
- [X] 2300005679_63060370
- [X] 2300009914_63060390
- [X] 2300028784_63060001
- [X] 2300036815_63063357
- [X] 2300055382_63061874
- [X] 2300055421_63061871
- [X] 2300055440_63061880
- [X] 230006894_63064950
- [X] 2300071111_63070356
- [X] 2300083434_63071675
- [X] 2300103609_63076239
- [X

[3.49406]

[19.40893]

otein_coding" preferred)
    CCDS status of transcript
    consequence rank according to this table
    translated, transcript or feature length (longer preferred)
"Wherever possible we would discourage you from summarising data in this way. "
**** DONE Mail alexis
CLOSED: [2023-08-20 Sun 13:45] SCHEDULED: <2023-08-20 Sun>
**** TODO Données simuscop 200x
SCHEDULED: <2023-12-21 Thu>
**** DONE En T2T avec liftover (filtre = spip) : ok mais lent et trop de variants :tests:
CLOSED: [2023-09-17 Sun 17:13] SCHEDULED: <2023-09-17 Sun>
1. Conversion en bed
#+begin_src sh :dir:~/code/sanger
open snvs-cento-sanger.csv | select chrom pos | insert pos2 {$in.pos } | to csv --separator="\t" | save snvs-cento-sanger.bed -f
#+end_src
2. Liftover avec UCSC (en ligne)
NB: vérifié sur le premier résultat en cherche le read contenant le variant (samtools view -r puis samtools view | grep en T2T) et avec l'aide d'IGV, on a un variant qui correspond en
chr1:10757746
3. En supposant que l'ordre des variants n'a pas changé, on ajoute simplement REF et ALT avec annotateLifted.jl
Annotation spip *très lente* : 1h13 !
Résultat:
2×3 DataFrame
 Row │ variant              meanQual  depth
     │ String               Float64   Int64
─────┼──────────────────────────────────────
   1 │ chr12:g.13594572      60.0      1
   2 │ chr17:g.10204026      60.0      1
144 found over 146
filter depth : another 0 missed variants
filter poly : another 0 missed variants
filter vep   : another 0 missed variants
Et on a trop de variants en sortie (7330 !)
**** DONE Mail Paul avec résultats filtre en T2T + nouveau schéma
CLOSED: [2023-09-17 Sun 23:15] SCHEDULED: <2023-09-17 Sun>
** TODO Medically relevant genes
SCHEDULED: <2023-12-18 Mon>
/Entered on/ [2023-10-18 Wed 22:37]
** TODO HG002 en T2T
/Entered on/ [2023-11-25 Sat 17:58]
https://github.com/marbl/HG002
*** TODO Tester les benchmark préliminaires
SCHEDULED: <2023-12-26 Tue>
https://ftp-trace.ncbi.nlm.nih.gov/ReferenceSamples/giab/data/AshkenazimTrio/analysis/NIST_HG002_DraftBenchmark_defrabbV0.011-20230725/
* Ré-interprétation :reanalysis:
** DONE Lancer tests sur données brutes [225/250] <(samples.csv)>  <(runs.waiting)>
CLOSED: [2023-10-14 Sat 11:58] SCHEDULED: <2023-10-08 Sun>
- [X] 100222_63015289
- [X] 1600304839_63051311
- [X] 1900007827_62913191
- [X] 1900398899_62999500
- [X] 1900486799_62913197
- [X] 2100422923_62952677
- [X] 2100458888_62933047
- [X] 2100601558_62903840
- [X] 2100609288_62905768
- [X] 2100609501_62905776
- [X] 2100614493_62951074
- [X] 2100622566_62908067
- [X] 2100622601_62908060
- [X] 2100622705_62908063
- [X] 2100640027_62911936
- [X] 2100645285_62913212
- [X] 2100661411_62914081
- [X] 2100661462_62914086
- [X] 2100708257_62921596
- [X] 2100738732_62926501
- [X] 2100738850_62926509
- [X] 2100746751_62926505
- [X] 2100746797_62926506
- [X] 2100782349_62931722
- [X] 2100782416_62931561
- [X] 2100782559_62931718
- [X] 2100799204_62934768
- [X] 2200010202_62940284
- [X] 2200023600_62940631
- [X] 2200024348_62999591
- [X] 2200027505_62942457
- [X] 2200038776_62943412
- [X] 2200041919_62943405
- [X] 2200088014_62951326
- [X] 2200146652_62959388
- [X] 2200151850_62960953
- [X] 2200160014_62959475
- [X] 2200160070_62959478
- [X] 2200201368_62967471
- [X] 2200201400_62967470
- [X] 2200265558_62976332
- [X] 2200265605_62976401
- [X] 2200267046_62975192
- [X] 2200273878_62999530
- [X] 2200279708_62977002
- [X] 2200284408_62979102
- [X] 2200293987_62979116
- [X] 2200294359_62979118
- [X] 2200306299_62982217
- [X] 2200306539_62982193
- [X] 220030671_62982211
- [X] 2200307058_62982231
- [X] 2200307108_62982196
- [X] 2200307136_62982221
- [X] 2200307199_62982239
- [X] 2200307230_62982234
- [X] 2200307262_62982219
- [X] 2200307297_62982227
- [X] 2200324510_62985453
- [X] 2200324549_62985478
- [X] 2200324573_62985445
- [X] 2200324594_62985467
- [X] 2200324606_62985463
- [X] 2200324614_62985459
- [X] 2200338306_62985430
- [X] 2200343880_62989407
- [X] 2200343910_62989460
- [X] 2200343938_62989451
- [X] 2200343966_62989456
- [X] 2200343993_62989440
- [X] 2200344013_62989464
- [X] 2200349749_62989465
- [X] 2200363462_62988848
- [X] 2200377880_62991993
- [X] 2200378032_62991991
- [X] 2200383996_62993828
- [X] 2200384015_62993796
- [X] 2200384046_62993822
- [X] 2200384117_62993808
- [X] 2200384187_62993825
- [X] 2200384231_62992898
- [X] 2200385658_63060260
- [X] 2200394260_62994732
- [X] 2200395817_62994742
- [X] 2200396731_62994737
- [X] 2200424073_62999579
- [X] 2200424207_62999632
- [X] 2200426178_62999630
- [X] 2200426243_62999635
- [X] 2200426466_62999605
- [X] 2200426642_62999627
- [X] 2200427406_62999649
- [X] 2200427512_62999639
- [X] 2200428953_62999572
- [X] 2200428981_62999600
- [X] 2200428999_62999592
- [X] 2200441970_63000868
- [X] 2200441989_63000882
- [X] 2200442135_63000864
- [X] 2200442216_63000886
- [X] 2200442257_63000951
- [X] 2200451801_63003573
- [X] 2200451862_63004218
- [X] 2200451894_63004210
- [X] 2200456165_63051294
- [X] 2200459865_63004933
- [X] 2200459968_63004937
- [X] 2200460073_63004943
- [X] 2200460121_63004684
- [X] 2200467051_63003856
- [X] 2200467225_63004940
- [X] 2200467261_63004930
- [X] 2200467338_63004925
- [X] 2200470099_63004485
- [X] 2200470142_63004480
- [X] 2200471780_63004362
- [X] 2200480910_63006466
- [X] 2200495073_63010427
- [X] 2200495510_63009152
- [X] 2200508677_63060252
- [X] 2200510531_63012582
- [X] 2200510628_63012549
- [X] 2200510657_63012554
- [X] 2200511249_63012533
- [X] 2200511274_63012586
- [X] 2200517952_63060399
- [X] 2200519525_63060439
- [X] 2200524009_63014044
- [X] 2200524609_63014046
- [X] 2200524616_63014048
- [X] 2200533429_63060425
- [X] 2200539735_63060406
- [X] 2200549908_63019339
- [X] 2200549965_63019349
- [X] 2200550414_63019357
- [X] 2200550471_63020031
- [X] 2200550490_63019351
- [X] 2200550505_63019340
- [X] 2200555565_63018614
- [X] 2200559438_63020029
- [X] 2200559682_63020030
- [X] 2200559713_63019623
- [X] 2200559739_63019626
- [X] 2200569969_63019991
- [X] 2200570001_63021580
- [X] 2200570025_63021490
- [X] 2200570035_63021491
- [X] 2200570042_63021493
- [X] 2200570050_63021494
- [X] 2200579897_63024910
- [X] 2200583995_63024866
- [X] 2200584035_63024905
- [X] 2200584069_63024888
- [X] 2200584126_63024810
- [X] 2200589507_63026712
- [X] 2200597365_63027994
- [X] 2200597480_63027988
- [X] 2200597752_63026853
- [X] 2200597778_63027992
- [X] 22005977_63026903
- [X] 2200609031_63026527
- [X] 2200614198_63113928
- [X] 2200620372_63030821
- [X] 2200620442_63030810
- [X] 2200620498_63030816
- [X] 2200620628_63031031
- [X] 2200622310_63030984
- [X] 2200622355_63030956
- [X] 2200625369_63028699
- [X] 2200625410_63028697
- [X] 2200625536_63028694
- [X] 2200630189_63030665
- [X] 2200635149_63033182
- [X] 2200644544_63037731
- [X] 2200644594_63037725
- [X] 2200650089_63038093
- [X] 2200666292_63076568
- [X] 2200669188_63036688
- [X] 2200669320_63040259
- [X] 2200669383_63040254
- [X] 2200669414_63040257
- [X] 2200669446_63040251
- [X] 2200680342_63105271
- [X] 2200694535_63042853
- [X] 2200694789_63042862
- [X] 2200694858_63042702
- [X] 2200694917_63042696
- [X] 2200699290_63043047
- [X] 2200699345_63040238
- [X] 2200699383_63043050
- [X] 2200699412_63040731
- [X] 220071551_63048935
- [X] 2200731515_63048963
- [X] 2200748145_63051198
- [X] 2200748171_63051213
- [X] 2200751046_63051249
- [X] 2200751101_63051234
- [X] 2200766471_63054590
- [X] 2200767731_63054595
- [X] 2200767822_63054464
- [X] 2200775505_63060410
- [X] 2200850441_63019345
- [X] 220597589_63026879
- [X] 2300003253_63060430
- [X] 2300005679_63060370
- [X] 2300009914_63060390
- [X] 2300028784_63060001
- [X] 2300036815_63063357
- [X] 2300055382_63061874
- [X] 2300055421_63061871
- [X] 2300055440_63061880
- [X] 230006894_63064950
- [X] 2300071111_63070356
- [X] 2300083434_63071675
- [X] 2300103609_63076239
- [X

Replacement in projects/bisonex.org at line 81 [17.35]

B:BD[3.57599] → [3.57599:63755]

Comparer variants cento à sortie bisonex: 50/121 confirmé en sanger, 71/121 non testé, 0 confirmés manqué par pipeline, 5 manqué mais non confirmés
CLOSED: [2023-11-08 Wed 00:19] SCHEDULED: <2023-11-04 Sat>
*** Comparger sanger : variant seul
Compliqué de reconstituer l'arbre familial. L'information est là mais demande du travail.
ON suppose que le variant n'est que dans la famille....
Résultats
❯ open sangerized.csv | where "Found by bisonex" == "found" | where "Confirmed in sanger" == "true" | length
50
❯ open sangerized.csv | where "Found by bisonex" == "found" | where "Confirmed in sanger" == "" | length
71
❯ open sangerized.csv | where "Found by bisonex" == "missed" | where "Confirmed in sanger" == "" | length
5
❯ open sangerized.csv | where "Found by bisonex" == "missed" | where "Confirmed in sanger" == "true" | length
0
[[id:cd79a77c-a0b6-4bb1-9e08-fe08dc89e3aa][Résultats finaux]]
*** DONE Regarder 5 variants manqués: 3 explicables, 2 non
CLOSED: [2023-11-09 Thu 00:22] SCHEDULED: <2023-11-05 Sun>
open searched.csv |  where "Found by bisonex" == "missed"
62982193  7884996 : haplotypecaller ok... -> filtré car AD=5 <= 10
63012582  102230760 : non présent haplotypcellar mais une délétion en 755 (en 754 CG -> C). Vérifié mobidetails
63019340  50721335 : non présent haplotypecaller (vérifié igv). vérifié mobidetails
63060439  26869324 : filtré car 15 reads
63109239  14358800 : présent haplotypecaller : filtré car DP=29 <= 30
Non présent haplotypecaller avec bcftools mais zgrep ok
zgrep 7884996 call_variant/haplotypecaller/*62982193*/*
zgrep 102230760 call_variant/haplotypecaller/*63012582*/*
zgrep 50721335 call_variant/haplotypecaller/*63019340*/*
zgrep 26869324 call_variant/haplotypecaller/*63060439*/*
zgrep 14358800 call_variant/haplotypecaller/*63109239*/*
*** DONE Flowchart
CLOSED: [2023-11-09 Thu 00:22]
*** DONE Refaire extraction
CLOSED: [2023-11-04 Sat 19:02] SCHEDULED: <2023-11-04 Sat>
*** DONE Refaire annotation avec mobidetails
CLOSED: [2023-11-04 Sat 19:02] SCHEDULED: <2023-11-04 Sat>
*** DONE Refaire annotation avec transcrit non reconnus
CLOSED: [2023-11-04 Sat 20:42] SCHEDULED: <2023-11-04 Sat>
5 transcrits, donnés égalemen tpar
#+begin_src nu
open annotated.csv | where coding != "negatif" | where chrom == ""
#+end_src
| 62676048 | NM_001080420.1 | SHANK3    | référénce non valide   |
| 62690893 | NM_001080420.1 | KDM6B     | idem                   |
| 62690893 | NM_001080420.1 | KDM6B     | même variant           |
| 62795429 | NM_016381.3    | TREX1 | NM_033629.5   |
| 63019340 | NM_001080420.1 | SHANK3 | NM_001372044.2 |
SCHEDULED: <2023-11-01 Wed>
*** DONE Rajouter variant pour 63009152
CLOSED: [2023-11-04 Sat 20:47] SCHEDULED: <2023-11-01 Wed>
*** DONE Regénérer annotation avec NC_
CLOSED: [2023-11-04 Sat 18:59] SCHEDULED: <2023-10-31 Tue>
*** DONE Comparer variants manqué avec sanger: 0 confirmés
CLOSED: [2023-11-06 Mon 23:48] SCHEDULED: <2023-11-04 Sat>
*** DONE Annoter variants avec sanger
CLOSED: [2023-11-08 Wed 23:17] SCHEDULED: <2023-11-07 Tue>
*** DONE Mail paul avec résultats
CLOSED: [2023-11-09 Thu 00:22] SCHEDULED: <2023-11-05 Sun>
*** DONE Vérifier coordonnées des 2 variants manquants
CLOSED: [2023-11-12 Sun 16:53] SCHEDULED: <2023-11-11 Sat>
Les 2 sont des homopolymer
- 1er = même variant mais représenté différement
- SHANK3 ?
**** PITX3: filtrée car AD=8
NB: représentation synonyme
Même séquence
  >hg38_dna range=chr10:102230742-102230777 5'pad=2 3'pad=2 strand=+ repeatMasking=none
GGAGCCAGCCCGGGGGGGCCCCCGCCCAGGCCCTG
>hg19_dna range=chr10:103990500-103990534 5'pad=0 3'pad=0 strand=+ repeatMasking=none
GGAGCCAGCCCGGGGGGGCCCCCGCCCAGGCCCTG
Selon IGV:
GGAGCCAGCCC(G)GGGGGGCCCCCGCCCAGGCCCTG
Selon cento
GGAGCCAGCCCGGGGGG(G)CCCCCGCCCAGGCCCTG
#+begin_src sh :dir ~/annex/data/bisonex/
bcftools filter -i 'POS=102230760' call_variant/haplotypecaller/*63012582*/*.vcf.gz
#+end_src
DP ok mais AD trop faible
 GT:AD:DP:GQ:PL  0/1:26,8:34:99:146,0,671
**** SHANK3: transcrit supprimé depuis: ok
Retrouvé par ERic: 50721504dup
On vérifie
#+begin_src sh :dir ~/annex/data/bisonex/
bcftools filter -i 'POS=50721504' call_variant/haplotypecaller/*63019340*/*.vcf.gz
#+end_src
#+begin_src sh :dir ~/annex/data/bisonex/
zgrep '50721504' annotate/full/*63019340*.tsv
#+end_src
*** TODO Sanger pour 4 VOUS manqués
SCHEDULED: <2023-12-20 Wed>
/Entered on/ [2023-11-13 Mon 22:40]
** TODO Chercher nouveaux gènes
SCHEDULED: <2023-12-20 Wed>
* Résultats
** TODO Speed-up BWA-mem
SCHEDULED: <2023-12-16 Sat>
** TODO Speed-up Hapotypecaller
SCHEDULED: <2023-12-16 Sat>
** TODO Refaire statistics avec happy+ vcfeval
SCHEDULED: <2023-12-11 Mon>
/Entered on/ [2023-11-18 Sat 20:13]
* Communication
** DONE Mail NGS-diag
CLOSED: [2023-10-06 Fri 08:04] SCHEDULED: <2023-10-06 Fri>
/Entered on/ [2023-10-04 Wed 19:33]
* Presentations
** DONE Abstract FOSDEM 2024
CLOSED: [2023-12-06 Wed 22:37] DEADLINE: <2023-12-07 Thu> SCHEDULED: <2023-12-04 Mon>
/Entered on/ [2023-12-03 Sun 23:17]
https://pretalx.fosdem.org/fosdem-2024/me/submissions/FSQC3U/
Diagnosing genetic diseases presents significant challenges. Modern sequencers produce vast amounts of data, requiring intensive processing and filtering before analysis. The intricate mechanisms inherent in rare diseases necessitate a high level of expertise from biologists to identify potential causes. This is why it is crucial to demonstrate these results come from accurate, efficient, and reproducible bioinformatics pipelines. Indeed, accuracy is vital for patient diagnosis, efficiency is needed to handle the growing data volume and patient backlog, and reproducibility is essential to ensure the quality of the results.
This talk is aimed at a diverse audience and will give feedback on Nix integration in our workflow.
It will focus on how Nix significantly improved reproducibility and discuss some challenges we encountered, especially with large databases and running on high-performance computing architectures.

[3.57599]

Comparer variants cento à sortie bisonex: 50/121 confirmé en sanger, 71/121 non testé, 0 confirmés manqué par pipeline, 5 manqué mais non confirmés
CLOSED: [2023-11-08 Wed 00:19] SCHEDULED: <2023-11-04 Sat>
*** Comparger sanger : variant seul
Compliqué de reconstituer l'arbre familial. L'information est là mais demande du travail.
ON suppose que le variant n'est que dans la famille....
Résultats
❯ open sangerized.csv | where "Found by bisonex" == "found" | where "Confirmed in sanger" == "true" | length
50
❯ open sangerized.csv | where "Found by bisonex" == "found" | where "Confirmed in sanger" == "" | length
71
❯ open sangerized.csv | where "Found by bisonex" == "missed" | where "Confirmed in sanger" == "" | length
5
❯ open sangerized.csv | where "Found by bisonex" == "missed" | where "Confirmed in sanger" == "true" | length
0
[[id:cd79a77c-a0b6-4bb1-9e08-fe08dc89e3aa][Résultats finaux]]
*** DONE Regarder 5 variants manqués: 3 explicables, 2 non
CLOSED: [2023-11-09 Thu 00:22] SCHEDULED: <2023-11-05 Sun>
open searched.csv |  where "Found by bisonex" == "missed"
62982193  7884996 : haplotypecaller ok... -> filtré car AD=5 <= 10
63012582  102230760 : non présent haplotypcellar mais une délétion en 755 (en 754 CG -> C). Vérifié mobidetails
63019340  50721335 : non présent haplotypecaller (vérifié igv). vérifié mobidetails
63060439  26869324 : filtré car 15 reads
63109239  14358800 : présent haplotypecaller : filtré car DP=29 <= 30
Non présent haplotypecaller avec bcftools mais zgrep ok
zgrep 7884996 call_variant/haplotypecaller/*62982193*/*
zgrep 102230760 call_variant/haplotypecaller/*63012582*/*
zgrep 50721335 call_variant/haplotypecaller/*63019340*/*
zgrep 26869324 call_variant/haplotypecaller/*63060439*/*
zgrep 14358800 call_variant/haplotypecaller/*63109239*/*
*** DONE Flowchart
CLOSED: [2023-11-09 Thu 00:22]
*** DONE Refaire extraction
CLOSED: [2023-11-04 Sat 19:02] SCHEDULED: <2023-11-04 Sat>
*** DONE Refaire annotation avec mobidetails
CLOSED: [2023-11-04 Sat 19:02] SCHEDULED: <2023-11-04 Sat>
*** DONE Refaire annotation avec transcrit non reconnus
CLOSED: [2023-11-04 Sat 20:42] SCHEDULED: <2023-11-04 Sat>
5 transcrits, donnés égalemen tpar
#+begin_src nu
open annotated.csv | where coding != "negatif" | where chrom == ""
#+end_src
| 62676048 | NM_001080420.1 | SHANK3    | référénce non valide   |
| 62690893 | NM_001080420.1 | KDM6B     | idem                   |
| 62690893 | NM_001080420.1 | KDM6B     | même variant           |
| 62795429 | NM_016381.3    | TREX1 | NM_033629.5   |
| 63019340 | NM_001080420.1 | SHANK3 | NM_001372044.2 |
SCHEDULED: <2023-11-01 Wed>
*** DONE Rajouter variant pour 63009152
CLOSED: [2023-11-04 Sat 20:47] SCHEDULED: <2023-11-01 Wed>
*** DONE Regénérer annotation avec NC_
CLOSED: [2023-11-04 Sat 18:59] SCHEDULED: <2023-10-31 Tue>
*** DONE Comparer variants manqué avec sanger: 0 confirmés
CLOSED: [2023-11-06 Mon 23:48] SCHEDULED: <2023-11-04 Sat>
*** DONE Annoter variants avec sanger
CLOSED: [2023-11-08 Wed 23:17] SCHEDULED: <2023-11-07 Tue>
*** DONE Mail paul avec résultats
CLOSED: [2023-11-09 Thu 00:22] SCHEDULED: <2023-11-05 Sun>
*** DONE Vérifier coordonnées des 2 variants manquants
CLOSED: [2023-11-12 Sun 16:53] SCHEDULED: <2023-11-11 Sat>
Les 2 sont des homopolymer
- 1er = même variant mais représenté différement
- SHANK3 ?
**** PITX3: filtrée car AD=8
NB: représentation synonyme
Même séquence
  >hg38_dna range=chr10:102230742-102230777 5'pad=2 3'pad=2 strand=+ repeatMasking=none
GGAGCCAGCCCGGGGGGGCCCCCGCCCAGGCCCTG
>hg19_dna range=chr10:103990500-103990534 5'pad=0 3'pad=0 strand=+ repeatMasking=none
GGAGCCAGCCCGGGGGGGCCCCCGCCCAGGCCCTG
Selon IGV:
GGAGCCAGCCC(G)GGGGGGCCCCCGCCCAGGCCCTG
Selon cento
GGAGCCAGCCCGGGGGG(G)CCCCCGCCCAGGCCCTG
#+begin_src sh :dir ~/annex/data/bisonex/
bcftools filter -i 'POS=102230760' call_variant/haplotypecaller/*63012582*/*.vcf.gz
#+end_src
DP ok mais AD trop faible
 GT:AD:DP:GQ:PL  0/1:26,8:34:99:146,0,671
**** SHANK3: transcrit supprimé depuis: ok
Retrouvé par ERic: 50721504dup
On vérifie
#+begin_src sh :dir ~/annex/data/bisonex/
bcftools filter -i 'POS=50721504' call_variant/haplotypecaller/*63019340*/*.vcf.gz
#+end_src
#+begin_src sh :dir ~/annex/data/bisonex/
zgrep '50721504' annotate/full/*63019340*.tsv
#+end_src
*** TODO Sanger pour 4 VOUS manqués
SCHEDULED: <2023-12-20 Wed>
/Entered on/ [2023-11-13 Mon 22:40]
** TODO Chercher nouveaux gènes
SCHEDULED: <2023-12-20 Wed>
* Résultats
** TODO Speed-up BWA-mem
SCHEDULED: <2023-12-21 Thu>
** TODO Speed-up Hapotypecaller
SCHEDULED: <2023-12-21 Thu>
* Communication
** DONE Mail NGS-diag
CLOSED: [2023-10-06 Fri 08:04] SCHEDULED: <2023-10-06 Fri>
/Entered on/ [2023-10-04 Wed 19:33]
* Presentations
** DONE Abstract FOSDEM 2024
CLOSED: [2023-12-06 Wed 22:37] DEADLINE: <2023-12-07 Thu> SCHEDULED: <2023-12-04 Mon>
/Entered on/ [2023-12-03 Sun 23:17]
https://pretalx.fosdem.org/fosdem-2024/me/submissions/FSQC3U/
Diagnosing genetic diseases presents significant challenges. Modern sequencers produce vast amounts of data, requiring intensive processing and filtering before analysis. The intricate mechanisms inherent in rare diseases necessitate a high level of expertise from biologists to identify potential causes. This is why it is crucial to demonstrate these results come from accurate, efficient, and reproducible bioinformatics pipelines. Indeed, accuracy is vital for patient diagnosis, efficiency is needed to handle the growing data volume and patient backlog, and reproducibility is essential to ensure the quality of the results.
This talk is aimed at a diverse audience and will give feedback on Nix integration in our workflow.
It will focus on how Nix significantly improved reproducibility and discuss some challenges we encountered, especially with large databases and running on high-performance computing architectures.

Replacement in notes/nushell.org at line 5 [20.60]

B:BD[18.57699] → [18.57699:57718]

** TODO Doom-emacs

[18.57699]

[18.57718]

** Emacs et tramp
Pour forcer tramp à utiliser bash
#+begin_src
SHELL="/bin/bash" ~/.emacs.d/bin/doom env
#+end_src

Deletion in notes/nushell.org at line 50 [20.60]
∅:D[2.1299] → [21.34303:34361]
B:BD[20.394] → [21.34303:34361]
```
* Limite
Problème avec nix sur les chemin -> zsh plutôt
```

File deletion: 20230613000928-tests_bacteriologie.org, tests-bacterio.org, tests_bacteriologie.org

BFD:BFD[22.1207] → [23.141:203]

BF:BFD[23.203] → [24.72:72]

BFD:BFD[22.1207] → [24.868:910]

BF:BFD[24.910] → [24.72:72]

BF:BFD[22.1207] → [7.51615:51662]

BF:BFD[7.51662] → [24.72:72]

B:BD[23.271] → [23.271:331]

∅:D[23.331] → [24.145:867]

B:BD[24.145] → [24.145:867]

#+title: Tests bactériologie
#+filetags: personal medecine
* Rapides : antigénique et moléculaire
** Antigénique: immuno-chromato
- Ag Legionella pneumophilia sg 1
  - limite : seulement sérogroupe 1, excrétion urinaire prolongée 1-2mois
- Streptococcus pneumonia
  - limite :  faux positifs = vaccin < 7 jours, enfants (colonositanio pharynax), croisement avec certains streptocoques oropharyngés
- C. difficile: GDH (Glutamate Déshydrogénase) -> si +, tester toxiques libres (faible sensbilité)
** Moléculaires
PCR temps réels
Inconvénient = coût (RIHN)
- Syndomique : méningite, respiratoire, gastro, IST, ostéo-articulaire
- Ciblé = tuberculose, C. difficile, S. agalactiae (dépistage), bactéries hautement résistantes aux carbapénèmes/vancomycine, SARM

File addition: cooking.org (----------)

[25.29]

* Desserts
  :PROPERTIES:
  :CUSTOM_ID: desserts
  :END:
** DONE Biscuit cuiller
   :PROPERTIES:
   :CUSTOM_ID: done-biscuit-cuiller
   :END:
(Patisserie, Leçons pas-à-pas) : 12min environ 3 blanc 75g sucre 55g
farine37g fécule 4 jaunes
** RETRY Biscuit de Savoie
   :PROPERTIES:
   :CUSTOM_ID: retry-biscuit-de-savoie
   :END:
[[https://www.meilleurduchef.com/cgi/mdc/l/fr/recette/biscuit-savoie.html][meilleur
du chef]]) : cuire vraiment plus longtemps en bas du four. Bien beurrer
et fariner.
** DONE [[https://www.bonappetit.com/recipe/blackout-cake][Blackout
cake]]
   :PROPERTIES:
   :CUSTOM_ID: done-blackout-cake
   :END:
*** Ingredients
    :PROPERTIES:
    :CUSTOM_ID: ingredients
    :END:
- Cake
  - Unsalted butter, room temperature (for pans)
  - 75g Dutch-processed cocoa powder, plus more for pans
  - 180g all-purpose flour
  - 1.5 teaspoons baking soda
  - 0.75 teaspoon baking powder
  - 1 large egg, room temperature
  - 1 large egg yolk, room temperature
  - 306g (packed) dark brown sugar
  - 170g sour cream, room temperature
  - 5 tablespoons vegetable oil
  - 2 teaspoons vanilla extract
  - 0.75 teaspoon kosher salt
- Pudding and Assembly
  - 33g Dutch-processed cocoa powder
  - 5 tablespoons cornstarch
  - 283g heavy cream
  - 4 large egg yolks, beaten to blend
  - 283g whole milk
  - 140g dark brown sugar
  - 0.75 teaspoon kosher salt
  - 114g milk chocolate, chopped
  - 1 teaspoon vanilla extract
- Frosting
  - 227 cup heavy cream
  - 3 tablespoons golden syrup (such as Lyle's Golden Syrup)
  - 0.1 teaspoon kosher salt
  - 340g bittersweet chocolate, chopped
  - 170g sour cream, room temperature
  - 2 tablespoons unsalted butter, room temperature
*** Instructions
    :PROPERTIES:
    :CUSTOM_ID: instructions
    :END:
1. Cake Arrange a rack in center of oven; preheat to 350°. Line two
   8x2"-deep round cake pans with parchment paper. Grease with butter,
   then dust with cocoa powder, tapping out excess.
   Sift flour, baking soda, baking powder, and remaining ¾ cup cocoa
   powder into a medium bowl, then whisk to combine. Whisk egg, egg
   yolk, brown sugar, sour cream, oil, vanilla, salt, and ¾ cup hot
   water in a large bowl until smooth. Whisk in dry ingredients until
   just combined.
   Divide batter between prepared pans. Bake cake until a tester
   inserted into the center comes out clean, 25--35 minutes. Transfer
   pans to a wire rack; let cake cool completely in pan. Invert onto a
   plate, then invert again.
   Do Ahead: Cake can be baked 2 days ahead. Store tightly wrapped at
   room temperature.
2. Pudding and Assembly Whisk cocoa powder and cornstarch in a large
   saucepan. Whisk in cream until smooth and no lumps remain. Add egg
   yolks, milk, brown sugar, and salt; whisk to combine. Bring to a boil
   over medium-high heat, whisking occasionally, then reduce heat to
   low. Continue to cook, whisking, until thick and smooth, 1--2
   minutes.
   Remove from heat and add chocolate and vanilla, stirring until
   chocolate is melted and mixture is smooth. Strain through a fine-mesh
   sieve into a medium bowl. Cover with plastic wrap, pressing directly
   onto surface of hot pudding to prevent a skin from forming. Chill
   until cold, at least 2 hours.
   Using a serrated knife and sawing in long, even strokes, carefully
   halve cakes lengthwise. Set aside the 3 prettiest layers for
   assembly. Crumble remaining layer with your fingers into fine crumbs
   (or push through a wire rack set inside a rimmed baking sheet). Place
   1 layer, cut side up, on a platter or cake stand.
   Remove plastic from chilled pudding and vigorously whisk until
   smooth. Using a rubber spatula, spread half of pudding over cake
   layer on stand, spreading to edges. Top with another cake layer, cut
   side down, and spread remaining pudding over cake. Top with third
   cake layer cut side down (leave top bare). Chill cake 1 hour and up
   to 8 to let pudding firm up.
   Do Ahead: Pudding can be made 1 day ahead. Keep chilled.
3. Frosting Bring cream, syrup, and salt to a boil in a large saucepan
   over medium-high heat. Remove from heat and stir in chocolate, sour
   cream, and butter. Let sit, stirring occasionally, until chocolate
   and butter are melted and mixture is smooth and no streaks of white
   remain. Transfer to a medium bowl. Let frosting sit at room
   temperature, stirring every 30 minutes or so, until thickened and
   spreadable (it will look like a broken chocolate sauce at first, but
   magically, about 1½ hours later, it will start to thicken). Stir
   until smooth. (If your kitchen is warmer than 72°, chill frosting 5
   minutes. Stir to combine cooler outer edges with warmer center, then
   chill another 5 minutes. It should be the consistency of sour cream;
   if not, chill another 5 minutes and stir.)
   Spread frosting all over top and sides of chilled cake. The frosting
   on top should be as smooth and level as possible, but it's okay if
   the sides look messy; the crumbs will hide any mistakes you make.
   Place cake stand on a sheet tray. Take a handful of cake crumbs and
   press into sides of cake. Repeat, turning cake as you go, to
   completely cover sides in crumbs. Sprinkle crumbs on outside edges of
   top layer.
   Do Ahead: Cake can be assembled 1 day ahead. Chill uncovered.
*** Notes :
    :PROPERTIES:
    :CUSTOM_ID: notes
    :END:
Avec un cercle 20cm, on peut faire un gâteau. 50min de cuisson à 190. On
peut couper le bord supérieur pour avoir quelques miettes puis 3
tranches. Un peu trop de glacage et pudding (10%) Résultat OK
** RETRY Bounty
   :PROPERTIES:
   :CUSTOM_ID: retry-bounty
   :END:
[[http://www.750g.com/bounty-maison-r97803.htm][750g]]) : prendre du bon
chocolat
- noix de coco
- lait concentré sucré
- chocolat noir
** RETRY Brioche
   :PROPERTIES:
   :CUSTOM_ID: retry-brioche
   :END:
*** [[[[http://www.enviedebienmanger.fr/fiche-recette/recette-brioche-pur-beurre]])][Enviedebienmanger
    :PROPERTIES:
    :CUSTOM_ID: httpwww.enviedebienmanger.frfiche-recetterecette-brioche-pur-beurreenviedebienmanger
    :END:
]] Bonne consistance et bon aspect. Attention, 30min est un maximum.
- 250 g de beurre gastronomique (+30 g pour beurrer les moules)
- 10 cl de lait entier
- 500 g de farine T45
- 18 g de levure fraîche
- 100 g de sucre
- 4 oeufs
- 1 jaune d'oeuf
- 12 g de sel (+ 1 pincée)
*** Au levain
    :PROPERTIES:
    :CUSTOM_ID: au-levain
    :END:
1. Ingredients
   - 225 grammes de levain actif
   - 500 grammes de farine T45
   - 110 grammes de cassonade sucre blond de canne
   - 8 grammes de sel
   - 3 gros oeufs
   - 200 grammes de beurre doux mou
   - lait ~50g
2. Notes 50min de cuisson à 180° 5h de pousse le lendemain Brioche
   moelleuse et aérée mais goût au levain trop fort Après avoir regardé
   d'autres recettes : => Augmenter le ratio farine/levain à 2/1 (au
   lieu de 0.5) pour le "starter" Exemple
   [[https://homegrownhappiness.co.nz/sourdough-brioche/]]
** RETRY Brownie
 [[https://tasty.co/recipe/ultimate-brownies]]
*** Notes
- 2/3 quantités -> ok pour moule à tarte
- café en poudre ok mais 1 seul petit sachet !
- 2 sachets d'expresso en poudre : ok, ne se sentent pas après cuisson
- cuisse 30min 180° dans plat à tarte
- bien respecter la dose de cacao en poudre, bien battre++
*** LOVEIT Serious eats
    :PROPERTIES:
    :CUSTOM_ID: loveit-serious-eats
    :END:
[[https://www.seriouseats.com/recipes/2018/02/bravetart-glossy-fudge-brownies.html]]
*** diviser quantité par 2 : brownie fin dans un plat à tarte. **
20-25min à 180 degré (30min = un peu trop cuit). Cuisson homogène
12 ounces unsalted butter (about 3 sticks; 340g) 6 ounces finely chopped
dark chocolate, about 72% (about 1 cup; 170g) 16 ounces white sugar
(about 2 1/4 cups; 450g) 2 ounces light brown sugar (about 1/4 cup,
packed; 55g) 1 3/4 teaspoons (4g) Diamond Crystal kosher salt; for table
salt, use about half as much by volume or the same weight 6 large eggs,
straight from the fridge (about 10 1/2 ounces; 295g) 1/2 ounce vanilla
extract (about 1 tablespoon; 15g) 1 teaspoon instant espresso powder,
such as Medaglia d'Oro (optional) 4 1/2 ounces all-purpose flour, such
as Gold Medal (about 1 cup, spooned; 125g) 4 ounces Dutch-process cocoa
powder, such as Cacao Barry Extra Brute (about 1 1/3 cups, spooned;
115g)
Directions
- différences entre les 2 : un peu plus de beurre pour SE, un peu plus
  de chocolat (normal + poudre) pour tasty
** TODO Cookies
https://www.seriouseats.com/the-food-lab-best-chocolate-chip-cookie-recipe
*** Ingredients
    8 ounces unsalted butter (2 sticks; 225g)
    1 standard ice cube (about 2 tablespoons; 30mL frozen water)
    10 ounces all-purpose flour (about 2 cups; 280g)
    3/4 teaspoon (3g) baking soda
    2 teaspoons Diamond Crystal kosher salt or 1 teaspoon table salt (4g)
    5 ounces granulated sugar (about 3/4 cup; 140g)
    2 large eggs (100g)
    2 teaspoons (10mL) vanilla extract
    5 ounces dark brown sugar (about 1/2 tightly packed cup plus 2 tablespoons; 140g)
    8 ounces (225g) semisweet chocolate, roughly chopped with a knife into 1/2- to 1/4-inch chunks
    Coarse sea salt, for garnish
*** Recette
10-11min cuisson 180
** RETRY Carrot cake
   :PROPERTIES:
   :CUSTOM_ID: retry-carrot-cake
   :END:
[[https://www.seriouseats.com/recipes/2017/10/carrot-cake-recipe.html]]
- un peu trop trop humide
- glacage non fait (version rapide = beurre + cream cheese + sucre
  glace)
** RETRY Cheesecake japonais
   :PROPERTIES:
   :CUSTOM_ID: retry-cheesecake-japonais
   :END:
*** Ingredients
    :PROPERTIES:
    :CUSTOM_ID: ingredients-1
    :END:
- 3 tablespoons/45 grams unsalted butter, at room temperature, plus more
  for greasing
- 5 large eggs, at room temperature
- 1 cup/225 grams cream cheese
- ½ cup/120 grams crème fraîche
- 1 teaspoon grated lemon zest
- 1 teaspoon vanilla extract
- ¼ teaspoon kosher salt
- ½ cup/100 grams plus 1 tablespoon superfine sugar
- ½ cup/65 grams cake flour
- 1 tablespoon confectioners' sugar, for garnish
*** Directions
    :PROPERTIES:
    :CUSTOM_ID: directions
    :END:
1.  Place rack in the center of the oven and heat to 400 degrees. Line
    bottom of an 8-by-3-inch round cake pan with parchment paper and
    butter only the bottom of the pan (so the cheesecake can rise). You
    can also use a springform pan; just wrap the bottom and sides with a
    double layer of foil, so the seams are covered.
2.  Separate eggs. Place whites in the bowl of an electric mixer fitted
    with the whisk attachment; place yolks in a small bowl.
3.  Place cream cheese in a large metal bowl or double boiler insert and
    place over a pot filled with 1 inch of simmering water. Stir until
    cream cheese is melted and smooth. Whisk in crème fraîche and 3
    tablespoons butter until well combined and smooth. Remove from heat
    and whisk in lemon zest, vanilla and salt. Whisk in egg yolks and 3
    tablespoons/40 grams superfine sugar. Sprinkle cake flour evenly
    over the top, then whisk it in.
4.  Beat the egg whites on medium speed until you start to see the wires
    of the whisk leave a trail in the whites. Slowly add the remaining 6
    tablespoons superfine sugar, a tablespoon at a time while beating.
    Continue to beat until whites are fluffy and hold a soft peak when
    beaters are lifted. Gently fold about one-quarter of the whites into
    the yolk mixture to lighten it. Then gently fold in remaining
    whites, taking care not to deflate batter. Pour into prepared pan.
5.  Place cake pan in a roasting pan or other pan that is at least as
    deep as the cake pan; transfer to the oven. Fill the larger pan with
    enough hot tap water to come one-quarter of the way up the sides of
    the cake pan. (The cake is really light, so if you pour in too much
    water it may float.)
6.  Bake until top of the cake is golden and doesn't give when you press
    it gently in the middle, 35 to 40 minutes.
7.  Turn off oven and crack the oven door so that it cools off. Leave
    cheesecake in the cooling-off oven for 2 hours so it cools slowly,
    which keeps the top from cracking.
8.  Lift cheesecake pan out of water and place on a wire rack. Let cool
    for another 2 hours. Cheesecake will deflate slightly.
9.  Run a knife around the edges of the cheesecake to loosen it from
    sides of pan. Remove sides of springform pan. If you used a regular
    cake pan, invert the cake onto a plate, lift off pan, peel off
    parchment, then invert it right side up on a serving plate.
10. Chill cake for at least 2 hours before serving. Cake can be stored,
    well wrapped, for up to 4 days in the refrigerator. Sift
    confectioners' sugar over top of cake just before serving.
*** Notes
    :PROPERTIES:
    :CUSTOM_ID: notes-1
    :END:
- Temps de cuisson : 25-30min à 200° = sommet doré et gâteau plutôt
  ferme. Au goût semble OK
- Diminué les temps de repos : 1h30 au four, 1h dehors et mangé
  directement
- Levée pendant la cuisson (30%) mais retombé par la suite au niveau
  initial (voire moins sur un côté !)
- Un peu d'eau a l'air d'être rentrée sous des coins du gâteau
Conclusion
- Globablement bon mais attention à l'étanchéité ! => mieux mettre de
  papier alu
- pas de beurre sur les côté du moule a priori (possibilité de mettre du
  papier sulfurisé : cf [[https://www.youtube.com/watch?v=adXmM-eqwz8]])
- bien mélanger la pâte (cf les 2vidéos)
- idéalement, on veux un dôme et que le gâteau ne dégonfle pas en
  dessous de la taille initiale. La recette du NYT mentionne qu'un
  dégonflement est inévitable
- Essayer d'autre méthode de cuisson pour avoir un gâteau qui "tient"
  mieux ? (plus longtemps et moins fort)
** RETRY Chocolate lavae cake
   :PROPERTIES:
   :CUSTOM_ID: retry-chocolate-lavae-cake
   :END:
*** MEH Uncooked
    :PROPERTIES:
    :CUSTOM_ID: meh-uncooked
    :END:
[[https://cooking.nytimes.com/recipes/1019957-chocolate-lava-cake-for-two]]
13min au four : très coulant à l'intérieur mais un petit goûte de pâte
non cuite. => recette de John Favreau avec une ganache congelée à
l'intérieur avant de cuire
*** LOVEIT Frozen ganache
    :PROPERTIES:
    :CUSTOM_ID: loveit-frozen-ganache
    :END:
[[https://www.bonappetit.com/recipe/bas-best-molten-chocolate-cake]]
Meilleur que la version uncooked. 2/3 des quantités = sert environ 2
gros ramequins
** RETRY Cinnamon rolls
   :PROPERTIES:
   :CUSTOM_ID: retry-cinnamon-rolls
   :END:
[[https://www.bingingwithbabish.com/recipes/cinnamonrolls?rq=cinnamon][de
Babish]]
- Le glacage est trop lourd (et seulement testé avec fromage frais +
  sucre) en soi !
- Soit réessayer la recette de babish (en petite quantités), soit
  simplement nature.
** RETRY Clafoutis aux pommes
   :PROPERTIES:
   :CUSTOM_ID: retry-clafoutis-aux-pommes
   :END:
[[http://www.ptitecuisinedepauline.com/article-clafoutis-aux-pommes-122364862.html][ptitecuisinedepauline]])
- Avec un peu plus de farine, on a un clafoutis bien compact.
** RETRY Cornbread (salé)
   :PROPERTIES:
   :CUSTOM_ID: retry-cornbread-salé
   :END:
[[https://www.seriouseats.com/recipes/2015/11/southern-unsweetened-cornbread-recipe.html][Seriouseats]]
Bien moelleux mais très mietteux. Probablement pas assez mélangé
** RETRY Crepes
   :PROPERTIES:
   :CUSTOM_ID: retry-crepes
   :END:
*** Marmiton
    :PROPERTIES:
    :CUSTOM_ID: marmiton
    :END:
[[https://www.marmiton.org/recettes/recette_pate-a-crepes-simple_27121.aspx]]
2.5 oeufs 250 g de farine 500g l de lait demi-écrémé 1.5 cuillères à
soupe d'huile 1 cuillère à café de rhum => décent
*** LOVEIT Raymond Oliver
    :PROPERTIES:
    :CUSTOM_ID: loveit-raymond-oliver
    :END:
1. Ingredients Recette initiale : [[youtube:FUO2zmDnSe8][source]]
   - 200g farine
   - 4 oeufs (suffisament pour absorper la farine)
   - 250mL de lait
   - 50g beurre
   - bière en quantité suffisante pour "napper" (400mL ??)
   - 1 CS huile
   - 4 CS de sucre
   - 2 pincées de sel
   - rhum (2/3) + anis (1/3) pour un total de 125mL soit 80mL de rhumé
     et 40mL d'anis
   Mon 1er essai pour 11 crepes moyennement fines :
   - 1 pincées de sel
   - 10cl lait
   - 3 oeufs
   - 3 CS sucre
   - vanille
   - 30g beurre
   - 130g farine
   - bière 15cl (le double dans la recette a priori) brune 6%
   - rhum 50g
   Au final : addictives, très molles, odeur du rhum, petit arrière-goût
   de bière après-coup
   2eme essai avec les quantités initiales et ~250mL de bière : petite
   amertume de la bière et pâte très très liquide. Il faut faire les
   crèpes très fines et bien les cuire pour éviter d'avoir le goût
   d'alcool Attention: quasi-impossible de les retoruner à la main, il
   faut utiliser une spatule. Ne pas avoir peur ed bien les cuire, elles
   ramolissent un peu ~15 crèpes fines
2. Instructions
   - Faire bouiller le lait avec sel + sucre + vanillet
   - Ajouter le beurre pour le faire fondre hors feu
   - Mélanger farine + oeufs (rajouter oeufs si besoin)
   - Ajouter mélange lait-beurre et mélanger
   - Ajouter les liqueurs
   - Ajouter bière jusqu'à "napper" la louche (texture très liquide,
     presque de l'eau)
   - Ne pas beurre la poêle et ne pas faire sauter les crèpes (retourner
     à la main)
*** MEH Au levain (Epicurious) sourdough
    :PROPERTIES:
    :CUSTOM_ID: meh-au-levain-epicurious-sourdough
    :END:
[[https://www.epicurious.com/recipes/food/views/sourdough-crepes]]
- 6 Tbsp. (100 g) sourdough starter
- 2 cups (250 g) all-purpose flour, divided
- 2 large eggs
- ¾ cup plus 1 Tbsp. (or more) milk
- 3 Tbsp. granulated sugar
- ½ tsp. baking soda
- ½ tsp. kosher salt
- 3 Tbsp. unsalted butter, melted, plus more room temperature
- Grapeseed or vegetable oil (for pan)
- Jam, crème fraîche, demerara sugar, and/or lox, (for serving;
  optional)
1. Notes
   - On ne sent pas le goût du levain
   - Crêpes classiques, sans plus
   - Pâte trop épaisse
** RETRY Croissants
   :PROPERTIES:
   :CUSTOM_ID: retry-croissants
   :END:
(PPAP). Pas encore ça... Remarques après plusieurs essais :
- 45min à 190° = trop !! pas assez cuits++ à l'intérieur mais un peu
  trop à l'extérieur. 180° était trop, essayer 160° ? Changer la
  position dans le four ?
- Bien laisser pousser avant d'enfourner (45min n'est pas assez !)
- Beurre qui s'échappe = pâte trop malmenée ?
- essayer cette recette :
  [[https://www.weekendbakery.com/posts/classic-french-croissant-recipe/]]
** RETRY Forêt noire
   :PROPERTIES:
   :CUSTOM_ID: retry-forêt-noire
   :END:
Recette de PPAP avec des framboises surgelées à la place des cerises
*** Notes
    :PROPERTIES:
    :CUSTOM_ID: notes-2
    :END:
Résultat final bon. Mais
- ne pas pocher les framboises, elles sont trop fragiles
- avec disque de diamètre 20cm, seulement 2 niveaux de génoise
- crème chantilly vanille tout juste pour la déco
- le chocolat fondu "serre" effectivement la chantilly (montée à 80%
  environ). Fondu au micro-ondes
- Le lendemaine, encore ok
- test de congélation
** RETRY Framboisier :
   :PROPERTIES:
   :CUSTOM_ID: retry-framboisier
   :END:
*** Recette de PPAP :
    :PROPERTIES:
    :CUSTOM_ID: recette-de-ppap
    :END:
- Bon mais pas assez de crème => 500g de crème liquide = tout juste
  assez de crème
- Problème principal = comment intégrer la gélatine ? => ne pas mettre
  la crème au frigo, attendre qu'elle refroidisse un peu et intégrer
  directement à la chantilly. Celle-ci va "dégonfler" un peu, mais après
  un passage au frigo, elle sera ferme
- Framboise surgelées : trop humide, il vaut mieux utiliser des fraîches
  pour la présentation
** RETRY Galette des rois
   :PROPERTIES:
   :CUSTOM_ID: retry-galette-des-rois
   :END:
[[https://www.youtube.com/watch?v=ETkk7QXbtlw][de Conticini]]
Pour *deux* crème frangipane (diviser par 2 pour une galette !!)
• 110 gr de beurre
• 190 gr de poudre d’amandes
• 130 gr de sucre glace
• 114 gr d’œufs
• 25 gr de rhum brun
• 300 gr de crème pâtissière
*** Notes
- Pâte feuilletée inversée plus intéressante que la simple => prendre la
  recette de PPAP
- Attention à mettre suffisament d'eau dans la pâte feuilletée : trop
  dure sinon (et se déchire)
- Frangipane sortie de la galette (alors qu'il en manquait) => bien souder
- le rhum après avoir cuit la crème patissière n'est pas trop fort (mais ne pas mélanger à la crème d'amande pour ne pas la faire trancher)
** RETRY Gâteau au chocolat
   :PROPERTIES:
   :CUSTOM_ID: retry-gâteau-au-chocolat
   :END:
[[https://tasty.co/recipe/the-ultimate-chocolate-cake][recette de
Tasty]]
*** Notes
    :PROPERTIES:
    :CUSTOM_ID: notes-3
    :END:
attention, bien cuire le gâteau et *bien* attendre qu'il soit froid
(sinon tombe en morceaux) !! Pas de bière mais la moitié en eau chaude.
Bien dilueer le café en poudre avant. Pour le glacage, quantité de sucre
divisée par 2, ok. Pas assez de glacage ?
** RETRY Gaufres
   :PROPERTIES:
   :CUSTOM_ID: retry-gaufres
   :END:
pas de souci de cuisson avec
[[https://www.hervecuisine.com/recette/gaufres-croustillantes-ultra-legeres/][cette
recette]]. Temps de repos qui fait la différence ? (Souvent pas assez
cuite dans les essais précédents)
** RETRY Glace
   :PROPERTIES:
   :CUSTOM_ID: retry-glace
   :END:
*** RETRY [[https://basicswithbabish.co/basicsepisodes/icecream][Recette
de Babish]]
    :PROPERTIES:
    :CUSTOM_ID: retry-recette-de-babish
    :END:
Avec +50% des quantités dans notre congélateur : pas de solidification
en 30min... Plutôt compter 1 à 2h ! Inutile de mélanger si c'est
liquide... Pour un premier essai, correct mais ne vaut pas le coup de
s'embêter autant ?
** RETRY Guimauve
   :PROPERTIES:
   :CUSTOM_ID: retry-guimauve
   :END:
[[http://www.jujube-en-cuisine.fr/marshmallow-ou-guimauve-maison/][jujube-en-cuisine]]):
trop sucré mais bonne texture
** TODO Ile flottante
   :PROPERTIES:
   :CUSTOM_ID: todo-ile-flottante
   :END:
[[https://cooking.nytimes.com/recipes/1017447-ile-flottante-with-fresh-cherries]]
Problèmes :
- sauce trop liquide après qq minutes de cuisson et malgré 2h au frais
  après. Goût un peu curieux avec la cardamone (diminuer dose ?)
- meringue aplatie après la cuisson à la vapeur => au four la prochaine
  fois
** TODO Lebkuchen
   :PROPERTIES:
   :CUSTOM_ID: todo-lebkuchen
   :END:
1er essai avec une recette de 750g il y a quelques années 2eme essai
avec cette recette :
[[https://www.bbcgoodfood.com/recipes/1941/lebkuchen]] mais plusieurs
modifications : Ajout : 1 oeufs, 25g sucre roux, orange confite,
noisettes concassées Globalement : plus de farine que mentionné Glacage
= 200g chocolat + huile de coco mais pas assez pour tous les gâteaux.
Important : couper cuisson quand les bords commencent à brûnir (10min à
180% max) => résultat : pas mal
3eme essai "free style" 200g farine blanche 50 farine complète 250g miel
de chataîgnier 100g beurre 90g poudre d'amandes levure
- cannelle, girofle, sirop d'érable, farine de sarrasin
Glacage : 200g chocolat + beurre + lait (un peu "granuleux"
visuellement)
9mm d'épaisseur : limite trop cuit à 15min à 170° ! Miel de chataîgner
trop fort, un peu atténué avec une glacage chocolat.
** RETRY Macarons
Pour 30 macarons Coque =
- 125g poudre d'amandes
- 125g sucre glace
- 1.5 blanc
Meringue
- 125g sucre semoule
- 35g eau
- 1.5 blanc
Temps de cuisson ~18min à 155° (après préchauffage à 175°) Ganache
- 80g lait
- 20g crème
- 150g chocolat 64%
- 30g beurre
*** Notes
    :PROPERTIES:
    :CUSTOM_ID: notes-4
    :END:
- Le plus important = Macaronage => mélanger jusqu'à pouvoir faire des
  "8"
- Recette de LPAP = valeur sûre. Faisable avec 2 plaques mais celle du
  bas (plaque pâtisserie) est moins jolie (parfois correct...), en mode
  chaleur tournante
- Pour la meringue italienne, on peut verser doucement 30s puis tout
  d'un coup en mélangeant à fond (cf recette de Raymon Oliver pour sa
  mousse de fruits)
- Recette de Felden avec du cacao en poudre : pâte d'amande trop épaisse
  mais résultant décevant malgré tout (plus un cookie) => des doutes à
  réessayer...
- Essayer avec meringue française
- Pas de sucre roux !
** RETRY Madeleine
   :PROPERTIES:
   :CUSTOM_ID: retry-madeleine
   :END:
*** DONE Recette de Felder: au chocolat
    :PROPERTIES:
    :CUSTOM_ID: done-recette-de-felder-au-chocolat
    :END:
Sans cacao : attention à la cuisson : pour des 2/3 de cuillère à soupe,
trop cuites en 7min à 215°... Bien remplir les moules (1 grosse cuillère
à soupe) et 10-12min de cuisson à 210 Un peu sèche/farineuse => Comparer
à LPAP
*** TODO LPAP
    :PROPERTIES:
    :CUSTOM_ID: todo-lpap
    :END:
Refaire, mais recette de référence normalement
** RETRY Mille-feuille
[[https://www.facebook.com/PhConticini/photos/a.108115932681384.17237.101025623390415/713491585477146/?type=3][de
Conticini]] : bien mettre un poids sur la pâte feuilletée pendant la
cuisson. Trop de gélatine (crème un peu trop gélatineuse)
   :PROPERTIES:
   :CUSTOM_ID: retry-mille-feuille-de-conticini-bien-mettre-un-poids-sur-la-pâte-feuilletée-pendant-la-cuisson.-trop-de-gélatine-crème-un-peu-trop-gélatineuse
   :END:
** RETRY Millionaire short-bread / Twix familial
   :PROPERTIES:
   :CUSTOM_ID: retry-millionaire-short-bread-twix-familial
   :END:
*** Notes
    :PROPERTIES:
    :CUSTOM_ID: notes-5
    :END:
- Ne pas trop étaler la pâte.
- Quantité pour avoir autant de caramel de que shortbread... Peut-être
  diminuer un
peu les doses de caramel ?
- J'ai utilisé 250g de chocolat, un peu juste sinon
*** Ingredients
    :PROPERTIES:
    :CUSTOM_ID: ingredients-2
    :END:
*** Directions
    :PROPERTIES:
    :CUSTOM_ID: directions-1
    :END:
** RETRY Moka
   :PROPERTIES:
   :CUSTOM_ID: retry-moka
   :END:
*** Ingrédients
Felder
sirop 12cl eau, 70g sucre, 20g rhum
biscuit 120g farine, 30g maizena, 1/2 sachet levure
5 oeufs, 150g scure
500g crème beurre (x2 pour quantité crème ?)
- 2.5 jaunes
- 120g sucre
- 50g eau
  180g beurre
  + meringue : 20g eau, 50g sucre, 35g blanc 13g sucre (x2 pour plus áeration ?)
café soluble/expresso
100g amandes effilées
*** Notes
Felder plutôt que PPAP :
- le biscuit est plus simple chez Felder et plus aéré
- doubler la dose de crème... => au final, un gâteau avec une légère
  couche de crème donc pas trop lourd
- beaucoup trop de sirop dans la recette, diviser au moins par 3
- le plus difficile (dans les 2 recettes ) : bien gérer le beurre
  - le prendre bien pommade
  - quand on le mélange aux oeufs encore chaud, refroidir les oeufs
    avant ... et y aller par petite quantités avec le beurre (NB:
    possible de recongeler si c'est trop liquide mais éviter...)
** RETRY Mousse au chocolate
   :PROPERTIES:
   :CUSTOM_ID: retry-mousse-au-chocolate
   :END:
*** Philippe Conticini : éviter une ganache trop liquide. Ne pas lésiner
sur les blancs. Pour 5 parts :
    :PROPERTIES:
    :CUSTOM_ID: philippe-conticini-éviter-une-ganache-trop-liquide.-ne-pas-lésiner-sur-les-blancs.-pour-5-parts
    :END:
- 37 g de sucre roux
- 250 g de blancs d'oeuf
- 70 g de lait demi-écrémé
- 150 g de crème liquide
- 180 g de chocolat noir (68%)
- 60 g de chocolat au lait
*** Au jus de pois chiches
    :PROPERTIES:
    :CUSTOM_ID: au-jus-de-pois-chiches
    :END:
- [[https://tasty.co/recipe/vegan-chocolate-mousse]] Pendant la
  préparation :: goût encore fort, légere nausée. 3h plus tard : ok
  Monte en neige comme des blancs normaux. Pour améliorer le goût :
- Tester avec du jus maison ?
- Meringue italienne ?
- Plus de vanille ?
** RETRY Mousse de fruit
   :PROPERTIES:
   :CUSTOM_ID: retry-mousse-de-fruit
   :END:
Recette meilleur du chef
** RETRY Napolitain
   :PROPERTIES:
   :CUSTOM_ID: retry-napolitain
   :END:
*** Ingrédients
    :PROPERTIES:
    :CUSTOM_ID: ingrédients
    :END:
Pour un gâteau de 16cm x 6.5cm x 8cm (longueur x largeur x hauteur)
- Beurre 200g
- Farine
- Levure 1 sachet
- 4 oeufs
- 200g de sucre environ
Ganache (diminuer les doses car il reste 1/4)
- 150g chocolat
- 100g crème 30%
*** Instructions
    :PROPERTIES:
    :CUSTOM_ID: instructions-1
    :END:
- Bien mélanger jaunes d'oeuf avec le sucre puis ajouter le beurre fondu
- Ajouter la farine et levure en poudre
- Séparer 2/3 et 1/3. Vanille dans le premier et poudre de cacao dans le
  second
- Meringue française avec 50g de sucre puis mélanger au reste
- 15min de cuisson à 180%
- Montage
** RETRY Oreo
   :PROPERTIES:
   :CUSTOM_ID: retry-oreo
   :END:
*** Bravetart
    :PROPERTIES:
    :CUSTOM_ID: bravetart
    :END:
1. Ingrédients For the Chocolate Wafers: 4 ounces unsalted butter (about
   8 tablespoons; 115g), creamy and soft, about 68°F (20°C) 3 1/2 ounces
   sugar (about 1/2 cup; 100g) 2 ounces golden syrup (about 3
   tablespoons; 55g), such as Lyle's 1/2 teaspoon baking soda 1/4
   teaspoon (1g) Diamond Crystal kosher salt; for table salt, use about
   half as much by volume or the same weight 1/4 teaspoon coconut
   extract (optional) 5 3/4 ounces bleached all-purpose flour (about 1
   1/4 cups, spooned; 165g), such as Gold Medal 1 1/4 ounces
   Dutch-process cocoa powder (about 1/3 cup plus 1 tablespoon; 35g),
   such as Cacao Barry Extra Brute, plus more for dusting For the
   Filling: 6 ounces unsalted butter (about 12 tablespoons; 170g) 1
   teaspoon vanilla extract 1/8 teaspoon Diamond Crystal kosher salt 8
   1/2 ounces powdered sugar (about 2 cups plus 1 tablespoon; 240g)
2. Notes
   - Ne pas faire les oreo trop large (3cm suffit)
   - La ganache est vraiment trop sucrée
   - Le biscuit passe avec du caco non sucré
** RETRY Pain au lait
   :PROPERTIES:
   :CUSTOM_ID: retry-pain-au-lait
   :END:
[[https://www.youtube.com/watch?v=wAKaJRl3Ieg][750g]]) : bon mais levée
sur la nuit semble préférable
** RETRY Pancake
   :PROPERTIES:
   :CUSTOM_ID: retry-pancake
   :END:
*** America test kitchen recipe. Pas mal et pas prise de tête
    :PROPERTIES:
    :CUSTOM_ID: america-test-kitchen-recipe.-pas-mal-et-pas-prise-de-tête
    :END:
*** Levain sourdough
    :PROPERTIES:
    :CUSTOM_ID: levain-sourdough
    :END:
[[https://www.kingarthurflour.com/recipes/classic-sourdough-waffles-or-pancakes-recipe]]
Avec "restes" de levain. Pancake moelleux mais bien cuire l'intérieur
(mettre à feu doux++)... Quantité pour 12 pancakes
** RETRY Paris-Brest
   :PROPERTIES:
   :CUSTOM_ID: retry-paris-brest
   :END:
*** PPAP
    :PROPERTIES:
    :CUSTOM_ID: ppap
    :END:
crème au beurre toujours un peu trop liquide. Vient du praliné "maison"
(loupé par ailleurs) ?
*** Felden
    :PROPERTIES:
    :CUSTOM_ID: felden
    :END:
Sans praliné, crème se tient bien
** RETRY Pâte à chou
   :PROPERTIES:
   :CUSTOM_ID: retry-pâte-à-chou
   :END:
(Patisserie, Leçons pas-à-pas) : 45-50min de cuisson
** RETRY Peanut Butter Pie
   :PROPERTIES:
   :CUSTOM_ID: retry-peanut-butter-pie
   :END:
*** Ingredients
    :PROPERTIES:
    :CUSTOM_ID: ingredients-3
    :END:
- 6 tablespoons/85 grams unsalted butter, melted, plus more for the pan
- ¾ cup/150 grams granulated sugar
- ¾ cup/75 grams unsweetened cocoa powder (not Dutch-processed)
- ½ cup/60 grams all-purpose flour
- ½ teaspoon kosher salt
- 1 ¼ cups/300 milliliters heavy cream
- 1 ½ cup/405 grams smooth, sweetened peanut butter, like Jif or Skippy
- 1 8-ounce/226 grams block full-fat cream cheese, at room temperature
- ⅔ cup/133 grams light brown sugar
- 1 teaspoon pure vanilla extract
- ½ teaspoon kosher salt
- 2 ounces/57 grams semisweet chocolate, chopped (optional)
- 1 tablespoon/14 grams unsalted butter (optional)
*** Directions
    :PROPERTIES:
    :CUSTOM_ID: directions-2
    :END:
1. Make the crust: Heat the oven to 350 degrees. Have a nonstick
   standard 9-inch pie plate ready, or generously butter a 9-inch
   standard pie plate. In a medium bowl, whisk together the sugar, cocoa
   powder, flour and salt. Add butter, stirring and mashing with a fork,
   until the crumbs are evenly moistened.
2. Transfer the crumbs to the prepared pan and press them evenly into
   the bottom and sides until crust is about 1/4-inch thick. Bake crust
   until it looks dry and set, 10 to 12 minutes. Transfer the pan to a
   rack to cool completely, about 30 minutes.
3. Make the filling: In a large bowl, whip the cream to stiff peaks
   using an electric mixer at medium-high speed. Set aside. In another
   large bowl, beat the peanut butter, cream cheese, brown sugar,
   vanilla and salt on medium speed until fluffy, about 2 minutes. Use a
   large rubber spatula to gently fold the whipped cream into the peanut
   butter mixture. Transfer the mixture to the prepared pan and smooth
   the top. Chill uncovered for at least 4 to 6 hours, until filling is
   set.
4. Make the topping, if using: In a microwave-safe bowl, melt the
   chocolate and the butter together in short bursts, stirring often.
   Transfer the chocolate mixture to a small plastic bag, and cut a
   1/8-inch hole in one corner. Drizzle the chocolate over the top to
   make a decorative pattern. (You may have some left over depending on
   your taste.) Serve immediately.
*** Modif
    :PROPERTIES:
    :CUSTOM_ID: modif
    :END:
- Pas de crème fouettée donc remplacée par une meringue française avec 4
  blancs
d'oeufs => résultat correct mais pas aussi "fluffy" que sur la photo
- Attention: la pâte à tarte ne durcira qu'à la sortie du four. 30min à
  180% est vraiment un maximum...
** RETRY Soufflé (Bocuse)
   :PROPERTIES:
   :CUSTOM_ID: retry-soufflé-bocuse
   :END:
Echec ! Souffé redescend au bout de 15min de cuisson et clairement pas
assez cuit après 20min à 210°. Après 35min, extérieur trop cuit et
intérieur limite sous-cuit (mangeable mais sans plus)... 2/3 des
quantité = 4 ramequins
** RETRY Tarte au chocolat
   :PROPERTIES:
   :CUSTOM_ID: retry-tarte-au-chocolat
   :END:
[[https://www.youtube.com/watch?v=ZISKki8AcE0][750g]]) : pas mal mais
plus avec une texture de mousse au chocolat
- 1 pâte sablée
- 300g de chocolat pâtissier
- 500g de crème fraîche liquide
- lait ? (donne plus une )
- 2 oeufs
*** NYT
    :PROPERTIES:
    :CUSTOM_ID: nyt
    :END:
1. Ingredients
2. Directions
3. Notes
   - Quantités pour 1 grande tarte + 2 tartelettes
   - La pâte a un peu attaché au papier cuisson
   - Au goût OK mais caramel trop liquide => ressayer en allant jusqu'au
     point ou ça sent légèrement le cramé
** RETRY Tarte aux pommes
   :PROPERTIES:
   :CUSTOM_ID: retry-tarte-aux-pommes
   :END:
*** RETRY PPAP
    :PROPERTIES:
    :CUSTOM_ID: retry-ppap
    :END:
Recette de la PPAP : pommes un peu crues, pâte ok. Mieux choisir les
pomme la prochaine fois et couper *très* fin
*** RETRY [[https://basicswithbabish.co/basicsepisodes/pies][Recette de
babish (double pie crust)]]
    :PROPERTIES:
    :CUSTOM_ID: retry-recette-de-babish-double-pie-crust
    :END:
Pâte trop farineuse au goût (seule) mais ok avec les pommes Cuisson : 1h
à 180° pour 4 pommes Pâtes très fragile après la cuisson (ne tient pas
au service) Pâte "inférieure" assez humide malgré la cuisson à blanc
mais après un passage au frigo, se conserve jusqu'au lendemain
*** TODO Bon appetit
    :PROPERTIES:
    :CUSTOM_ID: todo-bon-appetit
    :END:
[[https://www.bonappetit.com/recipe/bas-best-deep-dish-apple-pie]] Par
rapport à la version de Babish : cuisson longue (1h30-2h) et plus de
pommes
** RETRY Tiramisu
   :PROPERTIES:
   :CUSTOM_ID: retry-tiramisu
   :END:
1. [[https://www.seriouseats.com/2017/06/how-to-make-the-best-tiramisu.html]]
   => échec, pâte trop liquide car
2. Mieux avec 3 jaune + sucre en sabayon. Ajouter 200g mascarpone battu
   au fouet et battre le tout. Ajout 20cl crème fouettée délicatement.
   => au final, pas de prise au frigo, consistence crème fouettée molle.
** RETRY Yaourt à la yaourtière
   :PROPERTIES:
   :CUSTOM_ID: retry-yaourt-à-la-yaourtière
   :END:
5 yaourts = 1L de lait entier + 1 yaourt (avec ferments) avec 10h
- Un peu liquide au fond => essayer avec du lait entier en poudre
- lait de brebis : 1L + 3 CC de lait en poudre + 12h de fermentation =
  bien ferme. Diminuer lait en poudre
** RETRY Banana bread
   :PROPERTIES:
   :CUSTOM_ID: retry-banana-bread
   :END:
[[https://www.bonappetit.com/recipe/banana-bread]] Essai avec
- seulement 2 bananes trop mûres (important)
- crème remplacé par du lait
- sucre blanc au lieu du roux.
Au final, gâteau moelleux. 50min à 180°
* Plat principal
  :PROPERTIES:
  :CUSTOM_ID: plat-principal
  :END:
** RETRY Bolognaise
   :PROPERTIES:
   :CUSTOM_ID: retry-bolognaise
   :END:
*** Ingredients
    :PROPERTIES:
    :CUSTOM_ID: ingredients-4
    :END:
- 1 tablespoon vegetable oil
- 3 tablespoons butter plus 1 tablespoon for tossing the pasta
- ½ cup chopped onion
- ⅔ cup chopped celery
- ⅔ cup chopped carrot
- ¾ pound ground beef chuck (or you can use 1 part pork to 2 parts beef)
- Salt
- Black pepper, ground fresh from the mill
- 1 cup whole milk
- Whole nutmeg
- 1 cup dry white wine
- 1 ½ cups canned imported Italian plum tomatoes, cut up, with their
  juice
- 1 ¼ to 1 ½ pounds pasta
- Freshly grated parmigiano-reggiano cheese at the table
*** Directions
    :PROPERTIES:
    :CUSTOM_ID: directions-3
    :END:
1. Put the oil, butter and chopped onion in the pot and turn the heat on
   to medium. Cook and stir the onion until it has become translucent,
   then add the chopped celery and carrot. Cook for about 2 minutes,
   stirring vegetables to coat them well.
2. Add ground beef, a large pinch of salt and a few grindings of pepper.
   Crumble the meat with a fork, stir well and cook until the beef has
   lost its raw, red color.
3. Add milk and let it simmer gently, stirring frequently, until it has
   bubbled away completely. Add a tiny grating -- about 1/8 teaspoon --
   of nutmeg, and stir.
4. Add the wine, let it simmer until it has evaporated, then add the
   tomatoes and stir thoroughly to coat all ingredients well. When the
   tomatoes begin to bubble, turn the heat down so that the sauce cooks
   at the laziest of simmers, with just an intermittent bubble breaking
   through to the surface. Cook, uncovered, for 3 hours or more,
   stirring from time to time. While the sauce is cooking, you are
   likely to find that it begins to dry out and the fat separates from
   the meat. To keep it from sticking, add 1/2 cup of water whenever
   necessary. At the end, however, no water at all must be left and the
   fat must separate from the sauce. Taste and correct for salt.
5. Toss with cooked drained pasta, adding the tablespoon of butter, and
   serve with freshly grated Parmesan on the side.
*** Notes
    :PROPERTIES:
    :CUSTOM_ID: notes-6
    :END:
Pas mal (ajouté concentré de tomate + feuille basilic). Manque un peu de
tomate à la fin ?
** RETRY Cassoulet
   :PROPERTIES:
   :CUSTOM_ID: retry-cassoulet
   :END:
Recette [[http://www.confrerieducassoulet.com/la-recette.html]] Fait
avec :
- lard (gros morceaux)
- canard non confit (erreur)
- épaule de porc
- 2 saucisses de toulouse
Au final : 1h30 pour les haricots blancs (sans trempage) et 2h30 au four
pour commencer à avoir une croûte à 170°. => au final, le lard n'est pas
tout à fait bien mélangé donc peut-être le faire fondre avant / couper
en tout petit morceaux ? Sinon, pas mal mais bouillon un peu fade.
Essayer
[[https://foodwishes.blogspot.com/2016/03/cassoulet-worlds-most-complex-simple.html]]
** RETRY Choux de bruxelles frais rôtis
   :PROPERTIES:
   :CUSTOM_ID: retry-choux-de-bruxelles-frais-rôtis
   :END:
45min à 195° = fondant mais trop cuit à l'extérieur Cuits entiers +
huile + sel
** RETRY Coq au vin
   :PROPERTIES:
   :CUSTOM_ID: retry-coq-au-vin
   :END:
*** Ingredients
    :PROPERTIES:
    :CUSTOM_ID: ingredients-5
    :END:
- 3 pounds chicken legs and thighs
- 2 ½ teaspoons kosher salt, more as needed
- ½ teaspoon freshly ground black pepper, more to taste
- 3 cups hearty red wine, preferably from Burgundy
- 1 bay leaf
- 1 teaspoon chopped fresh thyme leaves
- 4 ounces lardons, pancetta or bacon, diced into 1/4-inch pieces (about
  1 cup)
- 3 tablespoons extra-virgin olive oil, more as needed
- 1 large onion, diced
- 1 large carrot, peeled and diced
- 8 ounces white or brown mushrooms, halved if large, and sliced (about
  4 cups)
- 2 garlic cloves, minced
- 1 teaspoon tomato paste
- 1 tablespoon all-purpose flour
- 2 tablespoons brandy
- 3 tablespoons unsalted butter
- 8 ounces peeled pearl onions (about 12 to 15 onions)
- Pinch sugar
- 2 slices white bread, cut into triangles, crusts removed
- ¼ cup chopped parsley, more for serving
*** Directions
    :PROPERTIES:
    :CUSTOM_ID: directions-4
    :END:
1. Season chicken with 2 1/4 teaspoons salt and 1/2 teaspoon pepper. In
   a large bowl, combine chicken, wine, bay leaf and thyme. Cover and
   refrigerate for at least 2 hours or, even better, overnight.
2. In a large Dutch oven or a heavy-bottomed pot with a tightfitting
   lid, cook lardons over medium-low heat until fat has rendered, and
   lardons are golden and crisp, 10 to 15 minutes. Using a slotted
   spoon, transfer lardons to a paper-towel-lined plate, leaving
   rendered fat in pot.
3. Remove chicken from wine, reserving the marinade. Pat chicken pieces
   with paper towels until very dry. Heat lardon fat over medium heat
   until it's just about to smoke. Working in batches if necessary, add
   chicken in a single layer and cook until well browned, 3 to 5 minutes
   per side. (Add oil if the pot looks a little dry.) Transfer chicken
   to a plate as it browns.
4. Add diced onion, carrot, half the mushrooms and the remaining 1/4
   teaspoon salt to pot. Cook until vegetables are lightly browned,
   about 8 minutes, stirring up any brown bits from the pot, and
   adjusting heat if necessary to prevent burning.
5. Stir in garlic and tomato paste and cook for 1 minute, then stir in
   flour and cook for another minute. Remove from heat, push vegetables
   to one side of pot, pour brandy into empty side, and ignite with a
   match. (If you're too nervous to ignite it, just cook brandy down for
   1 minute.) Once the flame dies down, add reserved marinade, bring to
   a boil, and reduce halfway (to 1 1/2 cups), about 12 minutes. Skim
   off any large pockets of foam that form on the surface.
6. Add chicken, any accumulated juices and half the cooked lardons to
   the pot. Cover and simmer over low heat for 1 hour, turning halfway
   through. Uncover pot and simmer for 15 minutes to thicken. Taste and
   add salt and pepper, if necessary.
7. Meanwhile, melt 1 tablespoon butter and 2 tablespoons oil in a
   nonstick or other large skillet over medium-high heat. Add pearl
   onions, a pinch of sugar and salt to taste. Cover, reduce heat to low
   and cook for 15 minutes, shaking skillet often to move onions around.
   Uncover, push onions to one side of skillet, add remaining mushrooms,
   and raise heat to medium-high. Continue to cook until browned,
   stirring mushrooms frequently, and gently tossing onions
   occasionally, 5 to 8 minutes. Remove onions and mushrooms from
   skillet, and wipe it out.
8. In same skillet, melt 2 tablespoons butter and 1 tablespoon oil over
   medium heat until bubbling. Add bread and toast on all sides until
   golden, about 2 minutes per side. (Adjust heat if needed to prevent
   burning.) Remove from skillet and sprinkle with salt.
9. To serve, dip croutons in wine sauce, then coat in parsley. Add pearl
   onions, mushrooms and remaining half of the cooked lardons to the
   pot. Baste with wine sauce, sprinkle with parsley and serve with
   croutons on top.
*** Notes
    :PROPERTIES:
    :CUSTOM_ID: notes-7
    :END:
Testé avec rhum : pas senti. Sans le surplus de sauce, ni crouton. Bonne
sauce mais riche.
** RETRY Cornbread
   :PROPERTIES:
   :CUSTOM_ID: retry-cornbread
   :END:
[[https://www.bonappetit.com/recipe/buttermilk-cornbread]] Bien moelleux
mais quantité approximative de farine et de lait (+50% ?). Trop de
levure (1 sachet) ?
** RETRY Couscous :
[[http://www.ptitecuisinedepauline.com/article-clafoutis-aux-pommes-122364862.html][recette
de semoule traditionnelle]]
   :PROPERTIES:
   :CUSTOM_ID: retry-couscous-recette-de-semoule-traditionnelle
   :END:
*** Graine
    :PROPERTIES:
    :CUSTOM_ID: graine
    :END:
- Huile (6 CS pour 1Kg) + humidifier. 30min de cuisson
- huile + eau puis cuisson 20min
- Eau si besoin + cuisson 15min
*** viande
    :PROPERTIES:
    :CUSTOM_ID: viande
    :END:
- curcuma 1CC
- gingembre poudre
- sel
- ras al nout++
- safran
- +/- tomates (concentré de tomate marche) Cuisson : pour des cuisses de
  poulet et de l'épaule d'agneau en morceaux, 2H30 dont 1h45 à la
  pression donne une viande très fondante
*** Légumes
    :PROPERTIES:
    :CUSTOM_ID: légumes
    :END:
Carottes, potiron, navets, courgettes
** RETRY Crevettes
   :PROPERTIES:
   :CUSTOM_ID: retry-crevettes
   :END:
*** Notes
    :PROPERTIES:
    :CUSTOM_ID: notes-8
    :END:
Pas mal, très rapide à faire. Je mets les crevettes dans la sauce
directement
*** Ingredients
    :PROPERTIES:
    :CUSTOM_ID: ingredients-6
    :END:
- 4 tablespoons unsalted butter
- 1 large clove garlic, minced
- Juice of two large limes
- 1 tablespoon Indonesian sambal (preferably sambal oelek, by Huy Fong,
  though sriracha will work as well)
- Kosher salt
- freshly ground black pepper to taste
- 1 pound large, fresh, shell-on shrimp
- 1 teaspoon jalapeño, seeded and chopped (optional)
- 2 tablespoons chopped cilantro
*** Directions
    :PROPERTIES:
    :CUSTOM_ID: directions-5
    :END:
1. In a small saucepan set over low heat, melt 1 tablespoon of butter.
   Add the garlic and cook, stirring for 2 minutes.
2. Add remaining 3 tablespoons butter to saucepan. When it melts, stir
   in the lime juice, chili sauce, salt and pepper. Turn off the heat
   and allow the sauce to rest.
3. Bring a large pot of well-salted water to a boil. Add the shrimp and
   cook for 2 minutes or until they are just firm and pink. Do not
   overcook. Drain into a colander and shake over the sink to remove
   excess moisture.
4. In a large bowl, toss the shrimp and chili sauce. Add jalapeño, if
   desired, sprinkle with cilantro and toss again.
** Haricots blancs
   :PROPERTIES:
   :CUSTOM_ID: haricots-blancs
   :END:
*** RETRY NYT: haricots blancs crémeux
    :PROPERTIES:
    :CUSTOM_ID: retry-nyt-haricots-blancs-crémeux
    :END:
[[https://cooking.nytimes.com/recipes/1019385-creamy-white-beans-with-herb-oil]]
1 citron entier pour 1Kg haricots blancs : je trouve que le citron est
trop agressif et ne va pas avec... Testé avec persil + menthe + basilic
** RETRY Falafels (traditionnels) :
   :PROPERTIES:
   :CUSTOM_ID: retry-falafels-traditionnels
   :END:
3 échecs successifs... Réssayer en
- mixant bien, bien la pâte
- mettre au frais pour éviter qu'ils ne se détachent dans la friture
OK avec ces 2 modifications !
** RETRY Kebab
   :PROPERTIES:
   :CUSTOM_ID: retry-kebab
   :END:
*** Grilled Chicken Pita With Yogurt Sauce and Arugula
    :PROPERTIES:
    :CUSTOM_ID: grilled-chicken-pita-with-yogurt-sauce-and-arugula
    :END:
1. Ingredients
2. Directions
3. Notes Cuisse de poulet = mauvaise idée. Très long à couper et la
   flemm d'enlever les tendons... Et difficile à griller ? Sauce : crème
   fraîche + menthe + persil + olive : pas convaincu par les olives. À
   refaire proprement
** RETRY Lablabi (Tunisian Chickpea Soup)
   :PROPERTIES:
   :CUSTOM_ID: retry-lablabi-tunisian-chickpea-soup
   :END:
*** Ingredients
    :PROPERTIES:
    :CUSTOM_ID: ingredients-7
    :END:
- 1 ¾ cup cooked chickpeas, or 1 (15-ounce) can chickpeas, drained and
  rinsed
- 2 teaspoons extra-virgin olive oil
- ½ teaspoon kosher salt, plus more to taste
- 1 teaspoon za'atar, plus more to taste
- 1 ½ cups dried chickpeas, soaked overnight and drained
- ¼ cup plus 3 tablespoons extra-virgin olive oil, plus more for serving
- 2 bay leaves
- 1 ½ teaspoon kosher salt, plus more to taste
- ½ loaf hearty rustic bread (about 8 ounces)
- 1 cup chopped onion, from 1 medium onion
- 6 garlic cloves, minced or finely grated
- 1 tablespoon ground cumin, plus more for serving
- 1 tablespoon tomato paste
- 1 tablespoon harissa paste, plus more for serving
- 3 tablespoons fresh lemon juice
- 1 tablespoon finely grated lemon zest, for serving
- ½ cup chopped flat-leaf parsley, for serving
*** Directions
    :PROPERTIES:
    :CUSTOM_ID: directions-6
    :END:
1. Prepare the crispy chickpeas: Transfer chickpeas to a rimmed baking
   sheet lined with a clean dish towel or paper towels. Cover with
   another towel (or paper towels) on top, rubbing gently to dry. Remove
   top towel and let air-dry for at least 30 minutes and preferably 1
   hour.
2. As chickpeas dry, start preparing the soup: In a Dutch oven or heavy
   stockpot, combine soaked chickpeas, 5 cups water, 1 tablespoon olive
   oil, bay leaves and 1/2 teaspoon salt over high heat. Bring to a boil
   for 2 to 3 minutes, then reduce heat to a simmer, cover and cook
   until chickpeas are tender, about 1 to 2 hours.
3. Heat oven to 400 degrees. While chickpeas are cooking, cut bread into
   thick slices, then tear slices into bite-size pieces. Place bread in
   one layer on large rimmed baking sheet and toast until crisp and
   light brown, about 10 minutes. Let cool on pan and set aside.
4. Finish the crunchy chickpeas: Raise oven temperature to 425 degrees.
   Remove the towels from baking sheet with the chickpeas, and toss the
   chickpeas with 2 teaspoons olive oil, 1/2 teaspoon salt and za'atar
   until well coated. Roast until golden and crispy, about 13 to 18
   minutes, tossing halfway through. When chickpeas are still hot,
   sprinkle lightly more salt. Taste and add more salt or za'atar, or
   both, if you'd like.
5. When the chickpeas for the soup are tender, discard bay leaves. Using
   a slotted spoon, transfer 2 cups of chickpeas, 1/2 cup of chickpea
   cooking liquid and 1/4 cup olive oil to a blender or food processor,
   and purée until smooth. (Alternatively, you can use an immersion
   blender to blitz half the chickpeas into a rough purée. Add the olive
   oil before puréeing. The broth won't be as silky as it would be
   puréed in a regular blender, but it will taste just as good.)
6. In a large skillet over medium-high, heat the remaining 2 tablespoons
   oil until shimmering. Add the onion and cook, stirring occasionally,
   until softened, about 5 minutes. Add garlic and cook until golden,
   about 2 minutes. Add the remaining 1 teaspoon salt, 1 tablespoon
   cumin and tomato paste and cook, stirring, until fragrant, 1 minute.
   Add a splash of the chickpea cooking liquid to the pan, and bring to
   a simmer to deglaze, scraping up the browned bits on the bottom of
   the pan. Turn off heat.
7. Add chickpea purée and onion mixture to soup, along with harissa and
   lemon juice, and stir well. Add a little water if soup seems too
   thick, and more salt, if needed.
8. To serve, divide toasted bread pieces among soup bowls, then ladle in
   soup. Garnish with lemon zest, parsley, olive oil, more cumin and
   some of the crispy chickpeas --- you'll have leftovers. Serve hot,
   with more harissa on the side.
*** Notes
    :PROPERTIES:
    :CUSTOM_ID: notes-9
    :END:
- version sans harissa et oublié le citron
- J'ai utilisé le jus des pois chiches pour la cuisson => mauvaise idée
- À refaire correctement
** RETRY Beef Stroganoff
   :PROPERTIES:
   :CUSTOM_ID: retry-beef-stroganoff
   :END:
*** Ingredients
    :PROPERTIES:
    :CUSTOM_ID: ingredients-8
    :END:
Kosher salt and freshly ground black pepper 1 ½ pounds sirloin roast, or
beef tenderloin, if you're feeling fancy 2 tablespoons all-purpose flour
1 ½ teaspoons hot paprika 1 tablespoon neutral oil, such as canola or
grapeseed 4 tablespoons unsalted butter ½ pound button mushrooms,
cleaned and cut into quarters 2 small shallots, thinly sliced 12 ounces
wide egg noodles ¼ cup dry white wine 1 cup heavy cream or crème fraîche
1 ½ teaspoons Worcestershire sauce 1 ½ teaspoons Dijon mustard Chopped
fresh parsley, for garnish
*** Directions
    :PROPERTIES:
    :CUSTOM_ID: directions-7
    :END:
Preparation
Bring a large pot of salted water to a boil. Cut the beef against the
grain into 1/2-inch slices, pound lightly, then cut those slices into
1-inch-wide strips. Add the flour, paprika, 1 1/2 teaspoons salt and 1
1/2 teaspoons pepper to a large shallow bowl and toss to combine. Dredge
the strips of meat in the flour mixture, shake them to remove excess
flour, then transfer them to a rimmed baking sheet. Place a large
skillet over high heat and swirl in the oil. When the oil begins to
shimmer, sauté the beef slices, in two batches, until they are well
browned on both sides but rare inside, 3 to 4 minutes per batch.
Transfer the seared meat to the baking sheet. Turn the heat down
slightly. Add 1 tablespoon of the butter to the pan. When it has melted
and started to foam, add the mushrooms, toss to coat them with the fat,
and season with salt and pepper. Cook, stirring frequently, until the
mushrooms have released their moisture and are a deep, dark brown, 12 to
15 minutes. About halfway into the process, add the sliced shallots and
1 tablespoon butter and stir to combine. While the mushrooms cook, add
the noodles to the boiling water, and cook until just done, about 10
minutes. Drain the noodles, and toss with the remaining 2 tablespoons
butter. Set aside. When the mushrooms and shallots are soft and
caramelized, deglaze the pan with the wine, scraping at all the stuck-on
bits on the pan's surface. When the wine has reduced by about half,
slowly stir in the cream, followed by the Worcestershire and mustard.
Add the meat, along with any accumulated juices, and stir to combine.
Cook, stirring occasionally, until the dish is hot and the beef is
medium-rare, 2 to 3 minutes. Taste, and adjust the seasonings. Serve the
noodles under or alongside the stroganoff; sprinkle stroganoff with
parsley.
*** Notes
    :PROPERTIES:
    :CUSTOM_ID: notes-10
    :END:
Pas mal
** DONE Haricots blancs à la tomate
   :PROPERTIES:
   :CUSTOM_ID: done-haricots-blancs-à-la-tomate
   :END:
Bien cuire la sauce tomate 10min avant d'ajouter le reste
[[https://www.thecookierookie.com/white-beans-recipe/]]
** Kluski na parze
   :PROPERTIES:
   :CUSTOM_ID: kluski-na-parze
   :END:
*** Ingrédients :
    :PROPERTIES:
    :CUSTOM_ID: ingrédients-1
    :END:
500 g de farine 1 verre de lait 3 oeufs 3 cuillères à soupe de beurre
fondu 30 gr de levure de boulangerie 1 pincée de sel
*** Préparation :
    :PROPERTIES:
    :CUSTOM_ID: préparation
    :END:
Délayez la levure dans un peu de lait tiède. Mélangez la avec un peu de
farine. Laissez reposer dans un endroit tiède. Quand elle a grossi de
moitié, ajoutez la farine, le sel, les oeufs et le beurre. Pétrissez à
la main. Remettez la pâte à lever dans un endroit tiède (couvrir d'un
linge humide ) . Formez avec la pâte des boules ressemblant à de
beignets. ( un verre à moutarde peut servir d'emporte pièces pour
découper la pate ) Laissez à nouveau lever la pâte et pour la cuisson,
prenez deux marmites, remplissez l' une à moitié d'eau, recouvrez-la
d'un linge propre et serrez le linge autour des bords avec de la
ficelle, portez l' eau à ébullition. Faites cuire les beignets à la
vapeur sur le linge pendant 10 minutes en recouvrant d' une marmite de
même diamètre. (Plus simple utiliser un couscoussier si vous en avez
un... ou un cuit-vapeur en adaptant la durée de la cuisson)
Les " kluski na parze "accompagnent un plat en sauce tel que des "
Rolades " le tout servi avec du chou rouge .
** RETRY Lasagnes
   :PROPERTIES:
   :CUSTOM_ID: retry-lasagnes
   :END:
[[https://www.bonappetit.com/recipe/ba-best-lasagna]] => ok mais
- bien saler béchamel et viande sinon un peu fade
- cuisson avec 1h four et 1h à la cocotte => meilleur au four ?
- NB : sauce = viande + un peu de liquide à côté. Je regrette de ne pas
  avoir une texture plus crémeuse
- on ne sent pas le parmesan
- la couche supérieure de pâte n'a pas cuite malgré le papier alu =>
  supprimer ?
** RETRY Porc fondant
   :PROPERTIES:
   :CUSTOM_ID: retry-porc-fondant
   :END:
*** Oignon rouge, ail chemisé, curry, porc à braiser. Le tout cuit
pendant 2h au moins avec couvercle
    :PROPERTIES:
    :CUSTOM_ID: oignon-rouge-ail-chemisé-curry-porc-à-braiser.-le-tout-cuit-pendant-2h-au-moins-avec-couvercle
    :END:
*** Pulled pork
    :PROPERTIES:
    :CUSTOM_ID: pulled-pork
    :END:
1. Ingredients
   - 1 tablespoon garlic powder
   - 1 tablespoon onion powder
   - 2 teaspoons hot or sweet smoked paprika
   - 2 teaspoons salt, plus more to taste
   - 1 teaspoon black pepper, plus more to taste
   - 3 to 4 pound boneless pork shoulder or pork butt, trimmed of most
     of its excess fat
   - 2 tablespoons vegetable oil, plus additional for greasing
   - 1 yellow onion, chopped (optional)
   - 1 (12-ounce) can dark soda, like Dr Pepper, root beer, cola or
     birch beer
   - ½ to 1 ½ cups homemade or store-bought barbecue sauce
   - Hot sauce (optional)
2. Directions
   1. In a small bowl, combine the garlic and onion powders, smoked
      paprika, salt and black pepper. Rub the spice mixture all over the
      pork. If you have time, cover with plastic wrap and refrigerate
      for 2 hours or up to overnight. If you don't, no worries; proceed
      to Step 2.
   2. Lightly grease the crock of a slow cooker. Heat 2 tablespoons
      vegetable oil in a large skillet over medium-high. Sear the pork
      until golden brown on all sides, about 2 minutes each side. Add
      onion, if using, to the slow cooker. Add the pork on top of the
      onion. Pour soda over the pork and set the slow cooker to low for
      6 to 8 hours, until the meat has collapsed and shreds easily.
   3. Drain most of the liquid from the slow cooker and shred the meat
      directly in the pot. Add about 1/2 cup of the barbecue sauce and
      stir to combine. (At this point, if you like crisp bits in your
      pulled pork, you can spread the shredded pork on a sheet pan and
      place under a broiler for a couple minutes then return to the slow
      cooker.) Taste and add more barbecue sauce, hot sauce, salt or
      pepper, if desired. Serve with soft rolls and extra sauce on the
      side.
3. Notes 6 heures à 160% avec "searing". Écrasé à la fourchette au bout
   de 3h pour permettre d'absorber le gras. Bien en burger avec sauce
   BBQ
*** RETRY Rouelle de porc
    :PROPERTIES:
    :CUSTOM_ID: retry-rouelle-de-porc
    :END:
Au four 160° 5h [[http://www.auxdelicesdemanue.com/-02]]
** RETRY Poulet cocotte (Bocuse)
   :PROPERTIES:
   :CUSTOM_ID: retry-poulet-cocotte-bocuse
   :END:
Cuisson : 15min au gaz et 45min au four (pas assez cuit sinon) Pdt :
bonnes Poulet : un peu sec
** RETRY Poulet glacage soja-miel-gingembre
   :PROPERTIES:
   :CUSTOM_ID: retry-poulet-glacage-soja-miel-gingembre
   :END:
*** Notes
    :PROPERTIES:
    :CUSTOM_ID: notes-11
    :END:
Cuisson à 1950 45min avec poulets non décongelés : ok, manque un peu de
crispiness À ressayer avec du gingembre
*** Ingredients
    :PROPERTIES:
    :CUSTOM_ID: ingredients-9
    :END:
- 2 tablespoons canola oil
- 1 tablespoon minced garlic
- 1 tablespoon minced ginger
- 6 tablespoons low-sodium soy sauce (see tip)
- 5 tablespoons mild honey, such as clover, acacia or orange blossom
- 3 tablespoons unsalted butter
- Kosher salt and black pepper
- 8 bone-in, skin-on chicken thighs (about 3 pounds)
- Lemon wedges, for serving
*** Directions
    :PROPERTIES:
    :CUSTOM_ID: directions-8
    :END:
1. Heat the oven to 425 degrees. Heat 1 tablespoon oil in a small
   saucepan over low heat. Add the garlic and ginger and cook, stirring
   occasionally, until softened, 3 minutes. Add the soy sauce and honey
   and simmer, stirring occasionally, until reduced and slightly
   thickened, about 10 minutes. Turn off the heat then whisk in the
   butter. Season with salt and pepper.
2. On an aluminum foil-lined rimmed baking sheet, season the chicken all
   over with salt and pepper. Add half the glaze and the remaining 1
   tablespoon oil and toss the chicken to coat. Arrange in an even
   layer, skin side up, and roast until browned, 15 minutes. Brush the
   chicken all over with 2 tablespoons of the remaining glaze. Roast
   until golden and cooked through, about 10 minutes.
3. Drizzle the chicken with the remaining glaze and serve with lemon
   wedges.
** RETRY Quiche
   :PROPERTIES:
   :CUSTOM_ID: retry-quiche
   :END:
Bien cuire le fond de tarte avant (15-20min). Les bords doivent être
parfaitement cuits !
** RETRY Soupe maïs-lait de coco (Des soupes qui nous font du bien)
   :PROPERTIES:
   :CUSTOM_ID: retry-soupe-maïs-lait-de-coco-des-soupes-qui-nous-font-du-bien
   :END:
Même en diminuant le ratio lait de coco/maïs à 40/60 au lieu de 60/40,
encore très riche. Essayer 70/30
** OK Soupe haricots verts-aspergs
   :PROPERTIES:
   :CUSTOM_ID: ok-soupe-haricots-verts-aspergs
   :END:
Filtrer pour les fibres !
** RETRY Tortilla
   :PROPERTIES:
   :CUSTOM_ID: retry-tortilla
   :END:
*** Ingredients
    :PROPERTIES:
    :CUSTOM_ID: ingredients-10
    :END:
- 4 cups all-purpose flour
- 1 teaspoon salt
- 2 teaspoons baking powder
- 2 tablespoons lard
- 1 1/2 cups water
*** Directions
    :PROPERTIES:
    :CUSTOM_ID: directions-9
    :END:
1. Whisk the flour, salt, and baking powder together in a mixing bowl.
   Mix in the lard with your fingers until the flour resembles cornmeal.
   Add the water and mix until the dough comes together; place on a
   lightly floured surface and knead a few minutes until smooth and
   elastic. Divide the dough into 24 equal pieces and roll each piece
   into a ball.
2. Preheat a large skillet over medium-high heat. Use a well-floured
   rolling pin to roll a dough ball into a thin, round tortilla. Place
   into the hot skillet, and cook until bubbly and golden; flip and
   continue cooking until golden on the other side. Place the cooked
   tortilla in a tortilla warmer; continue rolling and cooking the
   remaining dough.
*** Notes
    :PROPERTIES:
    :CUSTOM_ID: notes-12
    :END:
1er essai échec (recette de Chef John): trop dure, trop farineuse. Avec
cette recette ok mais :
- pâte bien hydratée++
- important de chauffer fort la poêle mais de cuire à feu moyen. 30s par
  côté x2 donc 2min au total
- étaler le plus fin possible
- si bulles = OK
- bulles !
*** Misc
    :PROPERTIES:
    :CUSTOM_ID: misc
    :END:
- [[https://www.reddit.com/r/AskCulinary/comments/1euuvv/why_do_my_homemade_tortillas_get_brittlehard_so/]])
- [[https://cooking.nytimes.com/recipes/1019621-sonoran-style-flour-tortillas]]
- [[https://www.seriouseats.com/recipes/2015/05/soft-chewy-flour-tortillas-recipe.html]]
** RETRY Vegan burger
   :PROPERTIES:
   :CUSTOM_ID: retry-vegan-burger
   :END:
Pois chiches 500g + 1 oeuf + assaissonnement + 150g de farine de
sarrasin = texture à la poêle OK. On peut probablement diminuer les
doses de farine à 100g Le plus important est d'avoir une pôle qui
n'attache pas. Source
[[https://www.bbcgoodfood.com/recipes/chickpea-coriander-burgers]] Avec
du yaourt grec : moins sec mais une petite amertume
** RETRY Agneau Biryani
   :PROPERTIES:
   :CUSTOM_ID: retry-agneau-biryani
   :END:
*** Ingredients
    :PROPERTIES:
    :CUSTOM_ID: ingredients-11
    :END:
- 4 green finger chiles (or serrano chiles), stems removed
- 8 garlic cloves, peeled
- 1 (4-inch) piece fresh ginger, peeled
- 2 medium yellow onions, peeled and quartered
- 2 Roma tomatoes, quartered
- 1 cup full-fat yogurt
- 1 cup fresh mint leaves
- 1 cup fresh cilantro leaves
- 1 tablespoon ground coriander
- 1 tablespoon ground cumin
- 1 teaspoon Kashmiri chile powder, plus more as needed
- ½ teaspoon ground turmeric
- 2 teaspoons kosher salt, plus more as needed
- 2 ½ to 3 pounds lamb chops (or boneless or bone-in lamb shoulder
  pieces)
- 3 (1/2-inch) Indian cinnamon sticks, or 1 large cinnamon stick
- 12 whole black peppercorns
- 6 cloves
- 6 green cardamom pods
- 1 tablespoon garam masala
- 1 cup neutral oil, such as grapeseed or canola
- 2 yellow onions, thinly sliced
- ½ teaspoon kosher salt
- Kosher salt
- 3 cups basmati rice
- 6 tablespoons whole milk
- ½ teaspoon saffron threads
- 2 cups mixed fresh cilantro and mint leaves
- 6 tablespoons unsalted butter, sliced
*** Directions
    :PROPERTIES:
    :CUSTOM_ID: directions-10
    :END:
1. Prepare the lamb marinade: Add the finger chiles, garlic and ginger
   to a food processor and process until finely chopped. Add the onions
   and tomatoes, process until smooth, and scrape into a bowl that will
   hold all the lamb and fit in your fridge. Add the yogurt, mint,
   cilantro, coriander, cumin, chile powder, turmeric and salt, and stir
   to combine. Add the lamb to the bowl and toss to coat in the
   marinade, then cover and refrigerate overnight.
2. Prepare the fried onions: In a Dutch oven or heavy pot, heat the oil
   over medium. Add the onions, season with salt, and sauté until
   browned, stirring occasionally, 25 to 30 minutes. Using a slotted
   spoon, transfer fried onions to a paper towel-lined plate. Using your
   hands, pull apart the fried onions to separate to prevent them from
   sticking together, and set aside.
3. Add the cinnamon, peppercorns, cloves and cardamom to the remaining
   hot oil, and fry over medium until fragrant, about 1 minute. Stir in
   the meat, its marinade and 1 cup water, and bring to a simmer over
   medium heat. Cook, stirring occasionally, until the meat is tender
   and the sauce is very thick and dark, about 2 1/2 hours, adjusting
   the heat as needed to maintain a low simmer. Stir in the garam masala
   and taste, adjusting with salt and chile powder as needed. Set aside.
4. Heat the oven to 350 degrees. Prepare the rice: Bring a large pot of
   lightly salted water to a boil and add the rice. Stir well and cook
   for 3 minutes, transfer to a colander in the sink to drain. Run some
   cool water on top to cool the rice; set aside.
5. Prepare the saffron milk for assembly: Warm the milk in a small
   saucepan over medium heat just until it steams. Remove from heat and
   add the saffron, crumbling it with your fingertips as you drop it
   into the milk. Set aside.
6. In a large, heavy, lidded pot, add about a third of the meat mixture
   in an even layer covering the bottom of the pot. Sprinkle the meat
   with a third of the herbs and a third of the rice, assembling lightly
   without packing the layers. Drizzle 2 tablespoons saffron milk over
   the rice and add about a third of the fried onions. Build two more
   layers of meat, herbs, rice, saffron milk and onions. Top with pats
   of butter and cover the pot with foil.
7. Put the lid on the pot of rice, transfer to the oven and bake until
   piping hot, about 1 hour. Let rest for about 10 minutes, then serve
   hot, digging all the way to the bottom of the pot with the serving
   spoon. To reheat, warm the biryani covered in the oven, or microwave.
*** Notes
    :PROPERTIES:
    :CUSTOM_ID: notes-13
    :END:
- Pas de coriandre... Fais avec de la menthe et du basilic
- Problème : que faire des clous de girofle + grains de poivre dans la
  sauce ? Je les ai enlevé à la main mais pas pratique...
- Couche supérieure de riz est un peu sèche et bien moins bonne que le
  fond (sauce++)
- Fait sans le beurre (cf commentaires), ni les oignons frits
- Temps de cuisson : 2h30 à la cocotte-minute pour 1kg700 d'épaule
  d'agneau entière = fondant. 1h au four + 10 min = riz cuit
Au total: réessayer avec de la coriandre, hydrater plus la couche
supérieur de riz
* Pains
  :PROPERTIES:
  :CUSTOM_ID: pains
  :END:
Pour une croûte : augmenter la vapeur
** Homemade Pita Bread
   :PROPERTIES:
   :CUSTOM_ID: homemade-pita-bread
   :END:
*** Ingredients
    :PROPERTIES:
    :CUSTOM_ID: ingredients-12
    :END:
*** Directions
    :PROPERTIES:
    :CUSTOM_ID: directions-11
    :END:
*** Notes
    :PROPERTIES:
    :CUSTOM_ID: notes-14
    :END:
Ne pas trop étaler sinon ne gonfle pas. Ok avec 3min + 3min de cuisson à
250° sur plaque à pizza
** Levain sourdough
   :PROPERTIES:
   :CUSTOM_ID: levain-sourdough-1
   :END:
*** RETRY Overnight country blonde (Flour, water, salt, yeast)
    :PROPERTIES:
    :CUSTOM_ID: retry-overnight-country-blonde-flour-water-salt-yeast
    :END:
1. Problèmes :
   - pâte difficile à façonner
   - colle au torchon malgré beaucoup de farine
   - résultat trop plat
   Solutions possibles
   - plus de folds/meilleure technique pour augmenter la "tenue"
     [[https://www.youtube.com/watch?v=vmb0wWKITBQ]]
   - torchon de lin et farine de riz pour éviter que ça ne colle
   - acheter un "coupe-pâte" pour façonner (cf "high hydratation
     technique"
   - diminuer l'hydratation sinon
   Source : [[https://www.youtube.com/watch?v=BJEHsvW2J6M]]
   THIS RECIPE MAKES 2 LOAVES, EACH ABOUT 1½ POUNDS, OR 1 BIG LOAF (SEE
   THE VARIATION). BULK FERMENTATION: 12 to 15 hours PROOF TIME: About 4
   hours SAMPLE SCHEDULE: Feed the levain at 9 a.m., mix the final dough
   at 5 p.m., shape into loaves at 8 a.m. the next morning, and bake at
   noon. Levain
2. Ingrédients INGREDIENT QUANTITY Mature, active levain 100 g White
   flour 400 g Whole wheat flour 100 g Water 400 g, 85ºF to 90ºF (29ºC
   to 32ºC)
   Final Dough Baker's Formula INGREDIENT FINAL DOUGH White flour 804 g
   90% Whole wheat flour 26 g 5% Rye flour 50 g5% Water 684 g,78% Fine
   sea salt 22 g 2.2%
3. Instuctions
   1. a. Feed the levain About 24 hours after your previous feeding of
      the levain, discard all but 100 grams of levain, leaving the
      remainder in your 6-quart tub.
   Add 400 grams of white flour, 100 grams of whole wheat flour, and 400
   grams of water at 85°F to 90°F (29°C to 32°C) and mix by hand just
   until incorporated. Cover and let rest at room temperature for 7 to 9
   hours before mixing the final dough.
   1. b. Autolyse After 7 to 9 hours, mix the 804 grams of white flour,
      the 50 grams of rye flour, and the 26 grams of whole wheat flour
      by hand in a 12-quart round tub. Add the 684 grams of 90°F to 95°F
      (32°C to 35°C) water and mix by hand just until incorporated.
      Cover and let rest for 20 to 30 minutes.
   2. Mix the final dough Sprinkle the 22 grams of salt evenly over the
      top of the dough.
   Put a container with about a finger's depth of warm water on your
   scale so you can easily remove the levain after it's weighed. With
   wet hands, transfer 216 grams (or more if your kitchen is cool; see
   "Seasonal Variations") of levain into the container. Transfer the
   weighed levain to the 12-quart dough tub, minimizing the amount of
   water transferred with it. Mix by hand, wetting your working hand
   before mixing so the dough doesn't stick to you. Use the pincer
   method alternating with folding the dough to fully integrate the
   ingredients. The target dough temperature at the end of the mix is
   77°F to 78°F (25°C to 26°C).
   1. Fold This dough needs three or four folds (see Step 3: Fold the
      Dough). Because overnight levain dough expands very slowly, it can
      be folded anytime that's convenient before you go to bed, perhaps
      doing two or three folds during the first hour and the final fold
      whenever convenient that evening.
   When the dough is nearly triple its original volume, or possibly a
   bit less in winter, 12 to 15 hours after mixing, it's ready to be
   divided.
   1. Divide With floured hands, gently ease the dough out of the tub
      and onto a lightly floured work surface. With your hands still
      floured, pick up the dough and ease it back down onto the work
      surface in a somewhat even shape. Use a bit of flour to dust the
      area in the middle where you'll cut the dough, then cut it into 2
      equal-size pieces with a dough knife or plastic dough scraper.
   2. Shape the dough Dust 2 proofing baskets with flour. Shape each
      piece of dough into a medium-tight ball following these
      instructions. Place each seam side down in its proofing basket.
   3. Proof Set the baskets side by side and cover with a kitchen towel,
      or place each basket in a nonperforated plastic bag. Proofing time
      should be about 4 hours, assuming a room temperature of about 70°F
      (21°C). Use the finger-dent test to determine when they are
      perfectly proofed and ready to bake.
   4. Preheat At least 45 minutes prior to baking, put a rack in the
      middle of the oven and put 2 Dutch ovens on the rack with their
      lids on. Preheat the oven to 475°F (245°C). If you only have 1
      Dutch oven, put the second loaf into the refrigerator about 20
      minutes before baking the first loaf and bake the loaves
      sequentially, giving the Dutch oven a 5-minute reheat after
      removing the first loaf.
   5. Bake For the next step, please be careful not to let your hands,
      fingers, or forearms touch the extremely hot Dutch oven.
   Invert the proofed loaf onto a lightly floured countertop, keeping in
   mind that the top of the loaf will be the side that was facing down
   while it was rising---the seam side. Remove the preheated Dutch oven
   from your kitchen oven, remove the lid, and carefully place the loaf
   in the Dutch oven seam side up. Cover and bake for 30 minutes, then
   uncover and bake for 20 to 25 minutes, until medium dark brown to
   very dark brown all around the loaf. Check after 15 minutes of baking
   uncovered in case your oven runs hot. Remove the Dutch oven and
   carefully tilt it to turn the loaf out. Let cool on a rack or set the
   loaf on its side so air can circulate around it. Let the loaf rest
   for at least 20 minutes before slicing.
** Pain à burger
   :PROPERTIES:
   :CUSTOM_ID: pain-à-burger
   :END:
*** Ingredients
    :PROPERTIES:
    :CUSTOM_ID: ingredients-13
    :END:
- 1 (.25 ounce) package active dry yeast (such as Fleischmann's
  ActiveDry Yeast®)
- 450g all-purpose flour, or as needed - divided
- 260g warm water (105 degrees F/41 degrees C)
- 1 large egg
- 3 tablespoons butter, melted
- 3 tablespoons white sugar
- 1 1/4 teaspoons salt
- 1 teaspoon olive oil
- 1 egg, beaten
- 1 tablespoon milk
- 1 teaspoon sesame seeds, or as needed
*** Directions
    :PROPERTIES:
    :CUSTOM_ID: directions-12
    :END:
1.  Line a baking sheet with a silicone mat or parchment paper.
2.  Place yeast into bowl of a large stand mixer; whisk in 1/2 cup flour
    and warm water until smooth. Let stand until mixture is foamy, 10 to
    15 minutes.
3.  Whisk 1 egg, melted butter, sugar, and salt thoroughly into yeast
    mixture. Add remaining flour (about 3 cups).
4.  Fit a dough hook onto stand mixer and knead the dough on low speed
    until soft and sticky, 5 to 6 minutes. Scrape sides if needed. Poke
    and prod the dough with a silicone spatula; if large amounts of
    dough stick to the spatula, add a little more flour.
5.  Transfer dough onto a floured work surface; dough will be sticky and
    elastic but not stick to your fingers. Form the dough lightly into a
    smooth, round shape, gently tucking loose ends underneath.
6.  Wipe out stand mixer bowl, drizzle olive oil into the bowl, and turn
    dough over in the bowl several times to coat surface thinly with
    oil. Cover bowl with aluminum foil. Let dough rise in a warm place
    until doubled, about 2 hours.
7.  Transfer dough to a floured work surface and pat to flatten bubbles
    and form into a slightly rounded rectangle of dough about 5x10
    inches and about 1/2 inch thick. Dust dough lightly with flour if
    needed. Cut dough into 8 equal pieces. Form each piece into a round
    shape, gently tucking ends underneath as before.
8.  Use your hands to gently pat and stretch the dough rounds into flat
    disc shapes about 1/2 inch thick. Arrange buns about 1/2 inch apart
    on prepared baking sheet. Dust buns very lightly with flour. Drape a
    piece of plastic wrap over the baking sheet (do not seal tightly).
    Let buns rise until doubled, about 1 hour.
9.  Preheat oven to 375 degrees F (190 degrees C).
10. Beat 1 egg with milk in a small bowl, using a fork, until mixture is
    thoroughly combined. Very gently and lightly brush tops of buns with
    egg wash without deflating the risen dough. Sprinkle each bun with
    sesame seeds.
11. Bake in the preheated oven until lightly browned on top, 15 to 17
    minutes. Buns will stick together slightly where they touch. Let
    cool completely, tear the buns apart, and slice in half crosswise to
    serve.
*** Notes
    :PROPERTIES:
    :CUSTOM_ID: notes-15
    :END:
Bonne recette, rappelle la brioche. Levée dans un four tiède : 2h et
30min respectivement. Cuisson 35min à 190° Façonner plus "en boule" pour
éviter qu'ils ne soient trop plats
** Pain au sarrasin
   :PROPERTIES:
   :CUSTOM_ID: pain-au-sarrasin
   :END:
*** 1/3 sarassin, 2/3 farine complète : goût curieux, un peu lourd
    :PROPERTIES:
    :CUSTOM_ID: sarassin-23-farine-complète-goût-curieux-un-peu-lourd
    :END:
** Pain blanc
   :PROPERTIES:
   :CUSTOM_ID: pain-blanc
   :END:
*** Recette du NYT "No-Knead" fonctionne bien, avec 1/2 CC de levure
pour 500g
    :PROPERTIES:
    :CUSTOM_ID: recette-du-nyt-no-knead-fonctionne-bien-avec-12-cc-de-levure-pour-500g
    :END:
** Pain complet
   :PROPERTIES:
   :CUSTOM_ID: pain-complet
   :END:
[[http://bakeryaddict.canalblog.com/archives/2012/07/24/24767223.html]]
*** Sans moule, pas mal
    :PROPERTIES:
    :CUSTOM_ID: sans-moule-pas-mal
    :END:
*** [[http://www.abreaducation.com/wholewheat.php][Breadeducation]] lève
mais un peu
    :PROPERTIES:
    :CUSTOM_ID: breadeducation-lève-mais-un-peu
    :END:
costaud
- seulement de la farine complète !
** Pain de seigle
   :PROPERTIES:
   :CUSTOM_ID: pain-de-seigle
   :END:
*** Majoritairement farine de seigle, avec un peu de farine de blé au
début +
    :PROPERTIES:
    :CUSTOM_ID: majoritairement-farine-de-seigle-avec-un-peu-de-farine-de-blé-au-début
    :END:
pendant processus
- 1h pour première levée, 1h (?) seconde levée : n'a pas assez levé
- 30min premiere levée, retravaillé 10min après, 1h15 seconde levée,
  cuisson 50min à 200° : pas levé, juste étalé.
** Pain pita
   :PROPERTIES:
   :CUSTOM_ID: pain-pita
   :END:
** Pizza
   :PROPERTIES:
   :CUSTOM_ID: pizza
   :END:
*** Overnight pizza from "Flour, yeast, water, salt"
    :PROPERTIES:
    :CUSTOM_ID: overnight-pizza-from-flour-yeast-water-salt
    :END:
Bonne pâte, difficulté est d'enfourner. Faire la pizza sur la pelle
directement... 10min à 250 + 3 min gril !
*** Overnight pizza avec levain from "Flour, yeast, water, salt"
    :PROPERTIES:
    :CUSTOM_ID: overnight-pizza-avec-levain-from-flour-yeast-water-salt
    :END:
Temps de cuisson identiques, on sent un peu le levain au niveau de la
croûte. Bonne pâte également
** Grissini
   :PROPERTIES:
   :CUSTOM_ID: grissini
   :END:
[[https://www.wildyeastblog.com/grissini-revisited/]]
*** Ingredients
    :PROPERTIES:
    :CUSTOM_ID: ingredients-14
    :END:
340 g flour 200 g water 9 g (1.5 t.) salt 23 g olive oil 228 g mature
100%-hydration sourdough starter (doit flotter)
*** Notes
    :PROPERTIES:
    :CUSTOM_ID: notes-16
    :END:
Cuisson ~15min à 200°
** Foccacia sourdough
   :PROPERTIES:
   :CUSTOM_ID: foccacia-sourdough
   :END:
Recette de "flour, water, yeast, salt"
*** Notes
    :PROPERTIES:
    :CUSTOM_ID: notes-17
    :END:
- Pâte un peu humide avec temps de cuisson x2