apraga/org - Change EPIVT3XCO6VCBLQSXDOHCZWV2NEZ2ALHX6CZBRQDMHOKRZKO4R2AC

Updating tasks

Created by Alexis Praga on December 3, 2023

EPIVT3XCO6VCBLQSXDOHCZWV2NEZ2ALHX6CZBRQDMHOKRZKO4R2AC

Dependencies

In channels

main

Change contents

Insertion in workout.org at line 6932 [5.1]

[4.190]

* <2023-12-03 Sun> Tricking
- B-kick
- Tornado kick

Replacement in projects.org at line 462 [5.123895]
B:BD[6.7155] → [6.7155:7183]
```
SCHEDULED: <2023-12-02 Sat>
```
[6.7155]
[7.433]
```
SCHEDULED: <2023-12-17 Sun>
```

Replacement in projects.org at line 469 [5.123895]

B:BD[7.623] → [2.109:171]

** TODO Renvoyer équipements box
SCHEDULED: <2023-12-02 Sat>

[7.623]

[2.171]

** DONE Renvoyer équipements box
CLOSED: [2023-12-03 Sun 23:19] SCHEDULED: <2023-12-02 Sat>

Insertion in projects.org at line 998 [5.123895]

[8.964]

[6.14742]

https://reviewer-feedback.springernature.com/feedback/11227/1405df9319bf5fb0dbbd4bacc8fe53b7/guidance

Replacement in projects/bisonex.org at line 3 [9.35]

B:BD[4.8602] → [4.8602:16794]

ttps://github.com/NixOS/nixpkgs/pull/206991][Restore building kent 404]]
CLOSED: [2023-05-06 Sat 17:40]
Review faite <2023-03-26 Sun> , atteinte merge]
Relancé <2023-05-06 Sat>
Kent 446 n'a pas ce problème donc PR inutile
***** DONE [[https://github.com/NixOS/nixpkgs/pull/223411][Ajouter les header to package]] (inc folder)
CLOSED: [2023-05-08 Mon 10:18] SCHEDULED: <2023-05-07 Sun>
Review à faire
https://github.com/NixOS/nixpkgs/pull/223411
Corrigé et plus besoin de la PR précédente
***** KILL [[https://github.com/NixOS/nixpkgs/pull/186462][BioDBBBigFile]] avec ces 2 changements
CLOSED: [2023-07-02 Sun 11:20]
**** KILL Version de kent déjà packagée : 404
CLOSED: [2023-03-27 Mon 16:43]
Compile mais les tests de passent pas
**** DONE Modifier selon PR https://github.com/NixOS/nixpkgs/pull/186462
CLOSED: [2023-07-30 Sun 22:01] SCHEDULED: <2023-07-30 Sun 20:00>
:LOGBOOK:
CLOCK: [2023-07-30 Sun 19:13]--[2023-07-30 Sun 20:50] =>  1:37
:END:
Modification nécessaire pour kent :
- plus de patch
- suppression d'une boucle dans postPatch
On supprime aussi NIX_BUILD_TOP
**** DONE Corriger PR biobigfile
CLOSED: [2023-11-30 Thu 21:52] SCHEDULED: <2023-12-05 Tue>
/Entered on/ [2023-10-15 Sun 17:21]
*** DONE [[https://github.com/NixOS/nixpkgs/pull/186459][BioDBHTS]]
CLOSED: [2023-05-06 Sat 08:49] SCHEDULED: <2023-04-15 Sat>
/Entered on/ [2022-08-10 Wed 14:28]
Correction pour review faites <2022-10-10 Mon>
*** DONE [[https://github.com/NixOS/nixpkgs/pull/186464][BioExtAlign]]
CLOSED: [2022-10-22 Sat 12:43] SCHEDULED: <2022-08-10 Wed>
/Entered on/ [2022-08-10 Wed 14:28]
Review <2022-10-10 Mon>, correction dans la journée.
Correction 2e passe, attente
Impossible de faire marcher les tests Car il ne trouve pas le module Bio::Tools::Align, qui est dans un dossier ailleurs dans le dépôt. Même en compilant tout le dépôt, cela ne fonctionne pas... On skip les tests.
*** TODO VEP
SCHEDULED: <2023-12-07 Thu>
** WAIT [[https://github.com/NixOS/nixpkgs/pull/230394][rtg-tools]] :vcfeval:
Soumis
** WAIT Package Spip https://github.com/NixOS/nixpkgs/pull/247476
** TODO Happy :happy:
*** TODO PR python 3 upstream
SCHEDULED: <2023-12-02 Sat>
*** TODO nixpkgs en l'état
SCHEDULED: <2023-12-02 Sat>
** PROJ SpliceAI
** TODO Bamsurgeon
/Entered on/ [2023-05-13 Sat 19:11]
*** TODO Velvet
** TODO PR Picard avec option pour gérer la mémoire
Similaire à
https://github.com/bioconda/bioconda-recipes/blob/master/recipes/picard/picard.sh
* Julia :julia:
** KILL XAM.jl: PR pour modification record :julia:
CLOSED: [2023-05-29 Mon 15:40] SCHEDULED: <2023-05-28 Sun>
/Entered on/ [2023-05-27 Sat 22:39]
** TODO XAMscissors.jl :xamscissors:
Modification de la séquence dans BAM.
*Pas de mise à jour de CIGAR*
On convertit en fastq et on lance le pipeline pour "corriger"
#+begin_src sh
cd /home/alex/code/bisonex/out/63003856/preprocessing/mapped
samtools view 63003856_S135.bam NC_000022.11 -o 63003856_S135_chr22.bam
cd /home/alex/recherche/bisonex/code/BamScissors.jl
cp ~/code/bisonex/out/63003856/preprocessing/mapped/63003856_S135_chr22.bam .
samtools index 63003856_chr22.bam
#+end_src
Le script va modifier le bam, le trier et générer le fastq. !!!
Attention: ne pas oublier l'option -n !!!
#+begin_src sh
time julia --project=.. insertVariant.jl
scp 63003856_S135_chr22_{1,2}.fq.gz meso:/Work/Users/apraga/bisonex/tests/bamscissors/
#+end_src
*** WAIT Implémenter les SNV avec VAF :snv:
Stratégie :
1. calculer la profondeur sur les positions
2. créer un dictionnaire { nom du reads : position dataframe }
3. itérer sur tous les reads et changer ceux marqués
**** DONE VAF = 1
CLOSED: [2023-05-29 Mon 15:34]
**** DONE VAF selon loi normale
CLOSED: [2023-05-29 Mon 15:35]
Tronquée si > 1
**** WAIT Tests unitaires
***** DONE NA12878: 1 gène sur chromosome 22
CLOSED: [2023-05-30 Tue 23:55]
root = "https://ftp-trace.ncbi.nlm.nih.gov/ReferenceSamples/giab/data/NA12878/Garvan_NA12878_HG001_HiSeq_Exome/"
#+begin_src sh
samtools view project.NIST_NIST7035_H7AP8ADXX_NA12878.bwa.markDuplicates.bam  chr22 -o project.NIST_NIST7035_H7AP8ADXX_NA12878_chr22.bam
samtools view project.NIST_NIST7035_H7AP8ADXX_NA12878_chr22.bam chr22:19419700-19424000 -o NIST7035_H7AP8ADXX_NA12878_chr22_MRPL40_hg19.bam
#+end_src
***** WAIT Pull request formatspeciment
https://github.com/BioJulia/FormatSpecimens.jl/pull/8
***** DONE Formatspecimens
CLOSED: [2023-05-29 Mon 23:03]
****** DONE 1 read
CLOSED: [2023-05-29 Mon 23:02]
****** DONE VAF sur 1 exon
CLOSED: [2023-05-29 Mon 23:03]
**** DONE [#A] Bug: perte de nombreux reads avec NA12878
CLOSED: [2023-08-19 Sat 20:45] SCHEDULED: <2023-08-18 Fri>
:PROPERTIES:
:ID:       5c1c36f3-f68e-4e6d-a7b6-61dca89abc37
:END:
Ex: chrX:g.124056226 : on passe de 65 reads à 1
Test xamscissors: pas de soucis...
On teste sur cette position +/- 200bp
#+begin_src sh :dir /home/alex/roam/research/bisonex/code/sanger
samtools view   /home/alex/code/bisonex/out/2300346867_NA12878-63118093_S260-GRCh38/preprocessing/mapped/2300346867_NA12878-63118093_S260-GRCh38.bam chrX:124056026-124056426 -o chrXsmall.bam
#+end_src
#+RESULTS:
***** DONE Vérifier profondeur avec dernière version :
CLOSED: [2023-08-19 Sat 20:34] SCHEDULED: <2023-08-19 Sat>
****** DONE chr20: profondeur ok
SCHEDULED: <2023-08-19 Sat>
****** DONE toutes les données
CLOSED: [2023-08-19 Sat 20:34] SCHEDULED: <2023-08-19 Sat>
Ok pour 7 variants (IGV) notament chromosome X
*** TODO Implémenter les indel avec VAF :indel:
*** TODO Soumission paquet
* Données
:PROPERTIES:
:CATEGORY: data
:END:
** DONE Remplacer bam par fastq sur mesocentre
CLOSED: [2023-04-16 Sun 16:33]
Commande
*** DONE Supprimer les fastq non "paired"
CLOSED: [2023-04-16 Sun 16:33]
nushell
Liste des fastq avec "paired-end" manquant
#+begin_src nu
ls **/*.fastq.gz | get name | path basename | split column "_" | get column1 | uniq -u | save single.txt
#+end_src
#+RESULTS:
: 62907927
: 62907970
: 62899606
: 62911287
: 62913201
: 62914084
: 62915905
: 62921595
: 62923065
: 62925220
: 62926503
: 62926502
: 62926500
: 62926499
: 62926498
: 62931719
: 62943423
: 62943400
: 62948290
: 62949205
: 62949206
: 62949118
: 62951284
: 62960792
: 62960785
: 62960787
: 62960617
: 62962561
: 62962692
: 62967473
: 62972194
: 62979102
On vérifie
#+begin_src nu
open single.txt  | lines | each {|e| ls $"fastq/*_($in)/*" | get 0  }
open single.txt  | lines | each {|e| ls $"fastq/*_($in)/*" | get 0.name }  | path basename | split column "_" | get column1 | uniq -c
#+end_src
On met tous dans un dossier (pas de suppression )
#+begin_src
open single.txt  | lines | each {|e| ls $"fastq/*_($in)/*" | get 0  }  | each {|e| ^mv $e.name bad-fastq/}
#+end_src
On vérifie que les dossiier sont videsj
 open single.txt  | lines | each {|e| ls $"fastq/*_($in)" | get 0.name } | ^ls -l $in
 Puis on supprime
 open single.txt  | lines | each {|e| ls $"fastq/*_($in)" | get 0.name } | ^rm -r $in
*** DONE Supprimer bam qui ont des fastq
CLOSED: [2023-04-16 Sun 16:33]
On liste les identifiants des fastq et bam dans un tableau avec leur type :
#+begin_src
let fastq = (ls fastq/*/*.fastq.gz | get name | parse "{dir}/{full_id}/{id}_{R}_001.fastq.gz"  | select dir id | uniq )
let bam = (ls bam/*/*.bam | get name | parse "{dir}/{full_id}/{id}_{S}.bqrt.bam"  | select dir id)
#+end_src
On groupe les résultat par identifiant (résultats = liste de records qui doit être convertie en table)
et on trie ceux qui n'ont qu'un fastq ou un bam
#+begin_src
let single = ( $bam | append $fastq | group-by id | transpose id files | get files | where {|x| ($x | length) == 1})
#+end_src
On convertit en table et on récupère seulement les bam
#+begin_src
$single | reduce {|it, acc| $acc | append $it} | where dir == bam | get id | each {|e| ^ls $"bam/*_($e)/*.bam"}
#+end_src
#+RESULTS:
: bam/2100656174_62913201/62913201_S52.bqrt.bam
: bam/2100733271_62925220/62925220_S33.bqrt.bam
: bam/2100738763_62926502/62926502_S108.bqrt.bam
: bam/2100746726_62926498/62926498_S105.bqrt.bam
:

[4.8602]

[4.16794]

ttps://github.com/NixOS/nixpkgs/pull/206991][Restore building kent 404]]
CLOSED: [2023-05-06 Sat 17:40]
Review faite <2023-03-26 Sun> , atteinte merge]
Relancé <2023-05-06 Sat>
Kent 446 n'a pas ce problème donc PR inutile
***** DONE [[https://github.com/NixOS/nixpkgs/pull/223411][Ajouter les header to package]] (inc folder)
CLOSED: [2023-05-08 Mon 10:18] SCHEDULED: <2023-05-07 Sun>
Review à faire
https://github.com/NixOS/nixpkgs/pull/223411
Corrigé et plus besoin de la PR précédente
***** KILL [[https://github.com/NixOS/nixpkgs/pull/186462][BioDBBBigFile]] avec ces 2 changements
CLOSED: [2023-07-02 Sun 11:20]
**** KILL Version de kent déjà packagée : 404
CLOSED: [2023-03-27 Mon 16:43]
Compile mais les tests de passent pas
**** DONE Modifier selon PR https://github.com/NixOS/nixpkgs/pull/186462
CLOSED: [2023-07-30 Sun 22:01] SCHEDULED: <2023-07-30 Sun 20:00>
:LOGBOOK:
CLOCK: [2023-07-30 Sun 19:13]--[2023-07-30 Sun 20:50] =>  1:37
:END:
Modification nécessaire pour kent :
- plus de patch
- suppression d'une boucle dans postPatch
On supprime aussi NIX_BUILD_TOP
**** DONE Corriger PR biobigfile
CLOSED: [2023-11-30 Thu 21:52] SCHEDULED: <2023-12-05 Tue>
/Entered on/ [2023-10-15 Sun 17:21]
*** DONE [[https://github.com/NixOS/nixpkgs/pull/186459][BioDBHTS]]
CLOSED: [2023-05-06 Sat 08:49] SCHEDULED: <2023-04-15 Sat>
/Entered on/ [2022-08-10 Wed 14:28]
Correction pour review faites <2022-10-10 Mon>
*** DONE [[https://github.com/NixOS/nixpkgs/pull/186464][BioExtAlign]]
CLOSED: [2022-10-22 Sat 12:43] SCHEDULED: <2022-08-10 Wed>
/Entered on/ [2022-08-10 Wed 14:28]
Review <2022-10-10 Mon>, correction dans la journée.
Correction 2e passe, attente
Impossible de faire marcher les tests Car il ne trouve pas le module Bio::Tools::Align, qui est dans un dossier ailleurs dans le dépôt. Même en compilant tout le dépôt, cela ne fonctionne pas... On skip les tests.
*** TODO VEP
SCHEDULED: <2023-12-07 Thu>
** WAIT [[https://github.com/NixOS/nixpkgs/pull/230394][rtg-tools]] :vcfeval:
Soumis
** WAIT Package Spip https://github.com/NixOS/nixpkgs/pull/247476
** TODO Happy :happy:
*** TODO PR python 3 upstream
SCHEDULED: <2023-12-08 Fri>
*** TODO nixpkgs en l'état
SCHEDULED: <2023-12-08 Fri>
** PROJ SpliceAI
** TODO Bamsurgeon
/Entered on/ [2023-05-13 Sat 19:11]
*** TODO Velvet
** TODO PR Picard avec option pour gérer la mémoire
Similaire à
https://github.com/bioconda/bioconda-recipes/blob/master/recipes/picard/picard.sh
* Julia :julia:
** KILL XAM.jl: PR pour modification record :julia:
CLOSED: [2023-05-29 Mon 15:40] SCHEDULED: <2023-05-28 Sun>
/Entered on/ [2023-05-27 Sat 22:39]
** TODO XAMscissors.jl :xamscissors:
Modification de la séquence dans BAM.
*Pas de mise à jour de CIGAR*
On convertit en fastq et on lance le pipeline pour "corriger"
#+begin_src sh
cd /home/alex/code/bisonex/out/63003856/preprocessing/mapped
samtools view 63003856_S135.bam NC_000022.11 -o 63003856_S135_chr22.bam
cd /home/alex/recherche/bisonex/code/BamScissors.jl
cp ~/code/bisonex/out/63003856/preprocessing/mapped/63003856_S135_chr22.bam .
samtools index 63003856_chr22.bam
#+end_src
Le script va modifier le bam, le trier et générer le fastq. !!!
Attention: ne pas oublier l'option -n !!!
#+begin_src sh
time julia --project=.. insertVariant.jl
scp 63003856_S135_chr22_{1,2}.fq.gz meso:/Work/Users/apraga/bisonex/tests/bamscissors/
#+end_src
*** WAIT Implémenter les SNV avec VAF :snv:
Stratégie :
1. calculer la profondeur sur les positions
2. créer un dictionnaire { nom du reads : position dataframe }
3. itérer sur tous les reads et changer ceux marqués
**** DONE VAF = 1
CLOSED: [2023-05-29 Mon 15:34]
**** DONE VAF selon loi normale
CLOSED: [2023-05-29 Mon 15:35]
Tronquée si > 1
**** WAIT Tests unitaires
***** DONE NA12878: 1 gène sur chromosome 22
CLOSED: [2023-05-30 Tue 23:55]
root = "https://ftp-trace.ncbi.nlm.nih.gov/ReferenceSamples/giab/data/NA12878/Garvan_NA12878_HG001_HiSeq_Exome/"
#+begin_src sh
samtools view project.NIST_NIST7035_H7AP8ADXX_NA12878.bwa.markDuplicates.bam  chr22 -o project.NIST_NIST7035_H7AP8ADXX_NA12878_chr22.bam
samtools view project.NIST_NIST7035_H7AP8ADXX_NA12878_chr22.bam chr22:19419700-19424000 -o NIST7035_H7AP8ADXX_NA12878_chr22_MRPL40_hg19.bam
#+end_src
***** WAIT Pull request formatspeciment
https://github.com/BioJulia/FormatSpecimens.jl/pull/8
***** DONE Formatspecimens
CLOSED: [2023-05-29 Mon 23:03]
****** DONE 1 read
CLOSED: [2023-05-29 Mon 23:02]
****** DONE VAF sur 1 exon
CLOSED: [2023-05-29 Mon 23:03]
**** DONE [#A] Bug: perte de nombreux reads avec NA12878
CLOSED: [2023-08-19 Sat 20:45] SCHEDULED: <2023-08-18 Fri>
:PROPERTIES:
:ID:       5c1c36f3-f68e-4e6d-a7b6-61dca89abc37
:END:
Ex: chrX:g.124056226 : on passe de 65 reads à 1
Test xamscissors: pas de soucis...
On teste sur cette position +/- 200bp
#+begin_src sh :dir /home/alex/roam/research/bisonex/code/sanger
samtools view   /home/alex/code/bisonex/out/2300346867_NA12878-63118093_S260-GRCh38/preprocessing/mapped/2300346867_NA12878-63118093_S260-GRCh38.bam chrX:124056026-124056426 -o chrXsmall.bam
#+end_src
#+RESULTS:
***** DONE Vérifier profondeur avec dernière version :
CLOSED: [2023-08-19 Sat 20:34] SCHEDULED: <2023-08-19 Sat>
****** DONE chr20: profondeur ok
SCHEDULED: <2023-08-19 Sat>
****** DONE toutes les données
CLOSED: [2023-08-19 Sat 20:34] SCHEDULED: <2023-08-19 Sat>
Ok pour 7 variants (IGV) notament chromosome X
*** TODO Implémenter les indel avec VAF :indel:
*** TODO Soumission paquet
* Données
:PROPERTIES:
:CATEGORY: data
:END:
** DONE Remplacer bam par fastq sur mesocentre
CLOSED: [2023-04-16 Sun 16:33]
Commande
*** DONE Supprimer les fastq non "paired"
CLOSED: [2023-04-16 Sun 16:33]
nushell
Liste des fastq avec "paired-end" manquant
#+begin_src nu
ls **/*.fastq.gz | get name | path basename | split column "_" | get column1 | uniq -u | save single.txt
#+end_src
#+RESULTS:
: 62907927
: 62907970
: 62899606
: 62911287
: 62913201
: 62914084
: 62915905
: 62921595
: 62923065
: 62925220
: 62926503
: 62926502
: 62926500
: 62926499
: 62926498
: 62931719
: 62943423
: 62943400
: 62948290
: 62949205
: 62949206
: 62949118
: 62951284
: 62960792
: 62960785
: 62960787
: 62960617
: 62962561
: 62962692
: 62967473
: 62972194
: 62979102
On vérifie
#+begin_src nu
open single.txt  | lines | each {|e| ls $"fastq/*_($in)/*" | get 0  }
open single.txt  | lines | each {|e| ls $"fastq/*_($in)/*" | get 0.name }  | path basename | split column "_" | get column1 | uniq -c
#+end_src
On met tous dans un dossier (pas de suppression )
#+begin_src
open single.txt  | lines | each {|e| ls $"fastq/*_($in)/*" | get 0  }  | each {|e| ^mv $e.name bad-fastq/}
#+end_src
On vérifie que les dossiier sont videsj
 open single.txt  | lines | each {|e| ls $"fastq/*_($in)" | get 0.name } | ^ls -l $in
 Puis on supprime
 open single.txt  | lines | each {|e| ls $"fastq/*_($in)" | get 0.name } | ^rm -r $in
*** DONE Supprimer bam qui ont des fastq
CLOSED: [2023-04-16 Sun 16:33]
On liste les identifiants des fastq et bam dans un tableau avec leur type :
#+begin_src
let fastq = (ls fastq/*/*.fastq.gz | get name | parse "{dir}/{full_id}/{id}_{R}_001.fastq.gz"  | select dir id | uniq )
let bam = (ls bam/*/*.bam | get name | parse "{dir}/{full_id}/{id}_{S}.bqrt.bam"  | select dir id)
#+end_src
On groupe les résultat par identifiant (résultats = liste de records qui doit être convertie en table)
et on trie ceux qui n'ont qu'un fastq ou un bam
#+begin_src
let single = ( $bam | append $fastq | group-by id | transpose id files | get files | where {|x| ($x | length) == 1})
#+end_src
On convertit en table et on récupère seulement les bam
#+begin_src
$single | reduce {|it, acc| $acc | append $it} | where dir == bam | get id | each {|e| ^ls $"bam/*_($e)/*.bam"}
#+end_src
#+RESULTS:
: bam/2100656174_62913201/62913201_S52.bqrt.bam
: bam/2100733271_62925220/62925220_S33.bqrt.bam
: bam/2100738763_62926502/62926502_S108.bqrt.bam
: bam/2100746726_62926498/62926498_S105.bqrt.bam
:

Replacement in projects/bisonex.org at line 30 [9.35]

B:BD[10.29620] → [10.29620:31884]

B:BD[10.31884] → [11.45600:49096]

B:BD[11.49096] → [8.17599:17629]

B:BD[8.17629] → [12.8220:10622]

rk/Users/apraga/bisonex/out/annotate
~/.nix-profile/bin/filter_vep -i vep/NA12878-sanger-all-GRCh38/NA12878-sanger-all-GRCh38.vep.vcf.gz  --filter 'PICK' | bcftools +counts
#+end_src
| Number | of | samples: |    1 |
| Number | of | SNPs:    | 6293 |
| Number | of | INDELs:  | 1515 |
| Number | of | MNPs:    | 1588 |
| Number | of | others:  |    0 |
| Number | of | sites:   | 9322 |
***** DONE Test NA12878 + variants sanger: vérifier sortie avec julia : ok
CLOSED: [2023-08-29 Tue 10:21] SCHEDULED: <2023-08-28 Mon>
143 variants/146 comme avant
***** DONE Relancer en T2T pour vérifier compatibilité :T2T:
CLOSED: [2023-08-29 Tue 11:03] SCHEDULED: <2023-08-29 Tue>
**** DONE Repasser les tests sanger sur NA12878
CLOSED: [2023-09-01 Fri 10:32] SCHEDULED: <2023-08-31 Thu>
2 variants manquants après filter vep
**** DONE Choisir le meilleur transcript nous-meme
CLOSED: [2023-09-01 Fri 10:32] SCHEDULED: <2023-09-01 Fri>
**** DONE Vérifier T2T passe
CLOSED: [2023-08-31 Thu 22:10] SCHEDULED: <2023-08-31 Thu>
**** DONE Revoir choix du transcrit + filtre  avec paul
CLOSED: [2023-09-08 Fri 22:46] SCHEDULED: <2023-09-06 Wed>
**** DONE Filtrer les variants selon les filtres d'Alexis et garder tous les résultat
CLOSED: [2023-09-10 Sun 15:39] SCHEDULED: <2023-09-09 Sat>
**** DONE Ajout colonne MANE SELECT et garder les autres
CLOSED: [2023-09-10 Sun 15:39] SCHEDULED: <2023-09-09 Sat>
**** DONE v1.0
CLOSED: [2023-09-11 Mon 19:11] SCHEDULED: <2023-09-09 Sat>
***** DONE Branche prod
CLOSED: [2023-09-10 Sun 15:44] SCHEDULED: <2023-09-09 Sat>
Merge depuis debug
***** DONE Mail alexis
CLOSED: [2023-09-01 Fri 10:32] SCHEDULED: <2023-08-31 Thu>
***** DONE Relancer test sanger
CLOSED: [2023-09-11 Mon 19:11] SCHEDULED: <2023-09-10 Sun>
***** DONE Mail Paul pour validation
CLOSED: [2023-09-11 Mon 19:11] SCHEDULED: <2023-09-10 Sun>
**** DONE Utiliser spliceAI >= 0.2 pour filtre au lieu de spip
CLOSED: [2023-09-11 Mon 21:48] SCHEDULED: <2023-09-11 Mon>
**** DONE Repasser tests sanger avec spliceAI
CLOSED: [2023-09-14 Thu 22:45] SCHEDULED: <2023-09-11 Mon>
**** DONE Corriger colonne récessive
CLOSED: [2023-09-14 Thu 22:57] SCHEDULED: <2023-09-14 Thu>
soit 1/1, soit 1/2
soit 0/1 avec 2 varian
ts par gene
*** KILL Comparer les annotations sur 63003856
CLOSED: [2023-08-28 Mon 17:28]
**** Relancer le nouveau pipeline
*** KILL Ancienne version
CLOSED: [2023-08-28 Mon 17:24]
**** KILL HGVS
CLOSED: [2023-08-28 Mon 17:24]
**** KILL Filtrer après VEP
CLOSED: [2023-08-28 Mon 17:24]
**** KILL OMIM
CLOSED: [2023-08-28 Mon 17:24]
**** KILL clinvar
CLOSED: [2023-08-28 Mon 17:24]
**** KILL ACMG incidental
CLOSED: [2023-08-28 Mon 17:24]
**** KILL Grantham
CLOSED: [2023-08-28 Mon 17:24]
**** KILL LRG
CLOSED: [2023-04-18 mar. 17:22] SCHEDULED: <2023-04-18 Tue>
Vu avec alexis, n’est plus à jour
**** KILL Gnomad
CLOSED: [2023-08-28 Mon 17:24]
*** DONE Réordonner les colonnes :annotation:
CLOSED: [2023-08-31 Thu 10:38] SCHEDULED: <2023-08-28 Mon>
Pas d'OMIM, pas de CADD, pas de spliceAI
*** DONE Ajouter gnomAD v3 :gnomadv3:
CLOSED: [2023-10-01 Sun 15:34] SCHEDULED: <2023-09-29 Fri>
/Entered on/ [2023-09-29 Fri 22:38]
Après discussion avec Mathieu sur le problème de certaines régions corrigées dans la v3 !
VEP utilise la v2 pour les exomes et v3 pour génomes
Il manquera pour les patients 1-107
On ne l'a pas dans la sortie de VEP jusque là
**** DONE Test sur 1 patient
CLOSED: [2023-09-30 Sat 23:54] SCHEDULED: <2023-09-29 Fri>
**** DONE Reprendre run batch
CLOSED: [2023-10-01 Sun 15:34]
** DONE Porter exactement la version d'Alexis sur Helios
CLOSED: [2023-01-14 Sat 17:56]
Branche "prod"
** KILL Tester version d'alexis avec Nix
CLOSED: [2023-06-14 Wed 22:37]
*** DONE Ajouter clinvar
CLOSED: [2022-11-13 Sun 19:37]
*** DONE Alignement
CLOSED: [2022-11-13 Sun 12:52]
*** DONE Haplotype caller
CLOSED: [2022-11-13 Sun 13:00]
*** KILL Filter
CLOSED: [2023-06-14 Wed 22:37]
- [X] depth
- [ ] comon snp not path
Problème avec liste des ID
**** KILL variant annotation
CLOSED: [2023-06-14 Wed 22:37]
Besoin de vep
*** KILL Variant calling
CLOSED: [2023-06-14 Wed 22:37]
** KILL Tester sarek
CLOSED: [2023-08-12 Sat 15:53]
#+begin_src sh
 module load apptainer/1.1.8
 nextflow run nf-core/sarek -profile test,singularity --outdir test-sarek
#+end_src
Les dépendences ne se téléchargent pas correctement, on les extrait à la main
#+begin_src sh
 rg -IN galaxyproject modules  | sed 's/ //g;s/:$//' | sort | uniq > deps.txt
#+end_src
 Nettoyage à la main
 Puis
 #+begin_src sh
 cat deps.txt | xargs -L1 singularity pull
 #+end_src
** DONE Support pour samplesheet
CLOSED: [2023-08-03 Thu 14:24] SCHEDULED: <2023-08-03 Thu 13:00>
/Entered on/ [2023-08-03 Thu 13:12]
** DONE Petit jeu de données : chr22 sur HG001
CLOSED: [2023-08-05 Sat 14:21] SCHEDULED: <2023-08-05 Sat>
** DONE Corriger OMIM annotation: manquant pour NMNAT1
CLOSED: [2023-09-16 Sat 22:47] SCHEDULED: <2023-09-16 Sat>
/Entered on/ [2023-09-16 Sat 19:32]
** PROJ Regarder la profondeur des variants rendus
/Entered on/ [2023-10-05 Thu 21:44]
* Documentation
:PROPERTIES:
:CATEGORY: doc
:END:
** DONE Procédure d'installation nix + dependences pour VM CHU
CLOSED: [2023-04-22 Sat 15:27] SCHEDULED: <2023-04-13 Thu>
* Bibliographie
** DONE Finir[cite:@alser2021]
CLOSED: [2023-09-26 Tue 11:26] SCHEDULED: <2023-09-22 Fri>
* Manuscript
:PROPERTIES:
:CATEGORY: manuscript
:END:
** DONE Flowchart pipeline (avec T2T)
CLOSED: [2023-09-17 Sun 23:15] SCHEDULED: <2023-09-17 Sun>
** Aligneur
*** DONE Figure: nombre de publication par aligneur
CLOSED: [2023-09-19 Tue 16:54] SCHEDULED: <2023-09-19 Tue>
/Ente
red on/ [2023-09-19 Tue 08:43]
*** DONE Biblio performance aligneur <(biblio aligneur)> <(aligneur)>
CLOSED: [2023-10-13 Fri 17:40] SCHEDULED: <2023-10-01 Sun>
*** DONE Figure: nombre d'articles citant les principaux aligneur par année
CLOSED: [2023-10-11 Wed 23:54] SCHEDULED: <2023-10-03 Tue>
Il faudrait utiliser pubmed en local, sinon c'est 10 000 requete par aligner !
*** DONE Figure: nombre d'articles citant les principaux aligneur
CLOSED: [2023-10-12 Thu 23:58] SCHEDULED: <2023-10-12 Thu>
Il faudrait utiliser pubmed en local, sinon c'est 10 000 requete par aligner !
On se base sur
** Appel de variant
*** DONE Biblio <(biblio appel variant)> <(appel variant)>
CLOSED: [2023-11-25 Sat 23:29] SCHEDULED: <2023-11-25 Sat 11:00>
*** TODO Finir biblio avec comparatifs [0/2]
SCHEDULED: <2023-11-26 Sun 13:00>
- [ ] [[file:~/research/bisonex/thesis/biblio.org::#Kumaran_2019][Performance assessment of variant calling pipelines using human whole exome sequencing and simulated data]]
- [ ] [[file:~/research/bisonex/thesis/biblio.org::*Comparaison de pipeline][Comparaison de pipeline]]
*** KILL Figure: nombre de publication par appel de variant
CLOSED: [2023-11-25 Sat 19:00] SCHEDULED: <2023-11-07 Tue>
/Entered on/ [2023-09-19 Tue 08:43]
Impossible d'utiliser pubmed car certains sont sur arxiv
** TODO Figure: nombre d'exomes par années
SCHEDULED: <2023-12-02 Sat>
/Entered on/ [2023-09-19 Tue 08:43]
* Tests :tests:
** KILL Non régression : version prod
CLOSED: [2023-05-23 Tue 08:46]
*** DONE ID common snp
CLOSED: [2022-11-19 Sat 21:36]
#+begin_src
$ wc -l ID_of_common_snp.txt
23194290 ID_of_common_snp.txt
$ wc -l /Work/Users/apraga/bisonex/database/dbSNP/ID_of_common_snp.txt
23194290 /Work/Users/apraga/bisonex/database/dbSNP/ID_of_common_snp.txt
#+end_src
*** DONE ID common snp not clinvar patho
CLOSED: [2022-12-11 Sun 20:11]
**** DONE Vérification du problème
CLOSED: [2022-12-11 Sun 16:30]
Sur le J:
21155134 /Work/Groups/bisonex/data/dbSNP/GRCh38.p13/ID_of_common_snp_not_clinvar_patho.txt.ref
Version de "non-régression"
21155076 database/dbSNP/ID_of_common_snp_not_clinvar_patho.txt
Nouvelle version
23193391 /Work/Groups/bisonex/data/dbSNP/GRCh38.p13/ID_of_common_snp_not_clinvar_patho.txt
Si on enlève les doublons
$ sort database/dbSNP/ID_of_common_snp_not_clinvar_patho.txt | uniq > old.txt
$ wc -l old.txt
21107097 old.txt
$ sort /Work

[10.29620]

[12.10622]

rk/Users/apraga/bisonex/out/annotate
~/.nix-profile/bin/filter_vep -i vep/NA12878-sanger-all-GRCh38/NA12878-sanger-all-GRCh38.vep.vcf.gz  --filter 'PICK' | bcftools +counts
#+end_src
| Number | of | samples: |    1 |
| Number | of | SNPs:    | 6293 |
| Number | of | INDELs:  | 1515 |
| Number | of | MNPs:    | 1588 |
| Number | of | others:  |    0 |
| Number | of | sites:   | 9322 |
***** DONE Test NA12878 + variants sanger: vérifier sortie avec julia : ok
CLOSED: [2023-08-29 Tue 10:21] SCHEDULED: <2023-08-28 Mon>
143 variants/146 comme avant
***** DONE Relancer en T2T pour vérifier compatibilité :T2T:
CLOSED: [2023-08-29 Tue 11:03] SCHEDULED: <2023-08-29 Tue>
**** DONE Repasser les tests sanger sur NA12878
CLOSED: [2023-09-01 Fri 10:32] SCHEDULED: <2023-08-31 Thu>
2 variants manquants après filter vep
**** DONE Choisir le meilleur transcript nous-meme
CLOSED: [2023-09-01 Fri 10:32] SCHEDULED: <2023-09-01 Fri>
**** DONE Vérifier T2T passe
CLOSED: [2023-08-31 Thu 22:10] SCHEDULED: <2023-08-31 Thu>
**** DONE Revoir choix du transcrit + filtre  avec paul
CLOSED: [2023-09-08 Fri 22:46] SCHEDULED: <2023-09-06 Wed>
**** DONE Filtrer les variants selon les filtres d'Alexis et garder tous les résultat
CLOSED: [2023-09-10 Sun 15:39] SCHEDULED: <2023-09-09 Sat>
**** DONE Ajout colonne MANE SELECT et garder les autres
CLOSED: [2023-09-10 Sun 15:39] SCHEDULED: <2023-09-09 Sat>
**** DONE v1.0
CLOSED: [2023-09-11 Mon 19:11] SCHEDULED: <2023-09-09 Sat>
***** DONE Branche prod
CLOSED: [2023-09-10 Sun 15:44] SCHEDULED: <2023-09-09 Sat>
Merge depuis debug
***** DONE Mail alexis
CLOSED: [2023-09-01 Fri 10:32] SCHEDULED: <2023-08-31 Thu>
***** DONE Relancer test sanger
CLOSED: [2023-09-11 Mon 19:11] SCHEDULED: <2023-09-10 Sun>
***** DONE Mail Paul pour validation
CLOSED: [2023-09-11 Mon 19:11] SCHEDULED: <2023-09-10 Sun>
**** DONE Utiliser spliceAI >= 0.2 pour filtre au lieu de spip
CLOSED: [2023-09-11 Mon 21:48] SCHEDULED: <2023-09-11 Mon>
**** DONE Repasser tests sanger avec spliceAI
CLOSED: [2023-09-14 Thu 22:45] SCHEDULED: <2023-09-11 Mon>
**** DONE Corriger colonne récessive
CLOSED: [2023-09-14 Thu 22:57] SCHEDULED: <2023-09-14 Thu>
soit 1/1, soit 1/2
soit 0/1 avec 2 variants par gene
*** KILL Comparer les annotations sur 63003856
CLOSED: [2023-08-28 Mon 17:28]
**** Relancer le nouveau pipeline
*** KILL Ancienne version
CLOSED: [2023-08-28 Mon 17:24]
**** KILL HGVS
CLOSED: [2023-08-28 Mon 17:24]
**** KILL Filtrer après VEP
CLOSED: [2023-08-28 Mon 17:24]
**** KILL OMIM
CLOSED: [2023-08-28 Mon 17:24]
**** KILL clinvar
CLOSED: [2023-08-28 Mon 17:24]
**** KILL ACMG incidental
CLOSED: [2023-08-28 Mon 17:24]
**** KILL Grantham
CLOSED: [2023-08-28 Mon 17:24]
**** KILL LRG
CLOSED: [2023-04-18 mar. 17:22] SCHEDULED: <2023-04-18 Tue>
Vu avec alexis, n’est plus à jour
**** KILL Gnomad
CLOSED: [2023-08-28 Mon 17:24]
*** DONE Réordonner les colonnes :annotation:
CLOSED: [2023-08-31 Thu 10:38] SCHEDULED: <2023-08-28 Mon>
Pas d'OMIM, pas de CADD, pas de spliceAI
*** DONE Ajouter gnomAD v3 :gnomadv3:
CLOSED: [2023-10-01 Sun 15:34] SCHEDULED: <2023-09-29 Fri>
/Entered on/ [2023-09-29 Fri 22:38]
Après discussion avec Mathieu sur le problème de certaines régions corrigées dans la v3 !
VEP utilise la v2 pour les exomes et v3 pour génomes
Il manquera pour les patients 1-107
On ne l'a pas dans la sortie de VEP jusque là
**** DONE Test sur 1 patient
CLOSED: [2023-09-30 Sat 23:54] SCHEDULED: <2023-09-29 Fri>
**** DONE Reprendre run batch
CLOSED: [2023-10-01 Sun 15:34]
** DONE Porter exactement la version d'Alexis sur Helios
CLOSED: [2023-01-14 Sat 17:56]
Branche "prod"
** KILL Tester version d'alexis avec Nix
CLOSED: [2023-06-14 Wed 22:37]
*** DONE Ajouter clinvar
CLOSED: [2022-11-13 Sun 19:37]
*** DONE Alignement
CLOSED: [2022-11-13 Sun 12:52]
*** DONE Haplotype caller
CLOSED: [2022-11-13 Sun 13:00]
*** KILL Filter
CLOSED: [2023-06-14 Wed 22:37]
- [X] depth
- [ ] comon snp not path
Problème avec liste des ID
**** KILL variant annotation
CLOSED: [2023-06-14 Wed 22:37]
Besoin de vep
*** KILL Variant calling
CLOSED: [2023-06-14 Wed 22:37]
** KILL Tester sarek
CLOSED: [2023-08-12 Sat 15:53]
#+begin_src sh
 module load apptainer/1.1.8
 nextflow run nf-core/sarek -profile test,singularity --outdir test-sarek
#+end_src
Les dépendences ne se téléchargent pas correctement, on les extrait à la main
#+begin_src sh
 rg -IN galaxyproject modules  | sed 's/ //g;s/:$//' | sort | uniq > deps.txt
#+end_src
 Nettoyage à la main
 Puis
 #+begin_src sh
 cat deps.txt | xargs -L1 singularity pull
 #+end_src
** DONE Support pour samplesheet
CLOSED: [2023-08-03 Thu 14:24] SCHEDULED: <2023-08-03 Thu 13:00>
/Entered on/ [2023-08-03 Thu 13:12]
** DONE Petit jeu de données : chr22 sur HG001
CLOSED: [2023-08-05 Sat 14:21] SCHEDULED: <2023-08-05 Sat>
** DONE Corriger OMIM annotation: manquant pour NMNAT1
CLOSED: [2023-09-16 Sat 22:47] SCHEDULED: <2023-09-16 Sat>
/Entered on/ [2023-09-16 Sat 19:32]
** PROJ Regarder la profondeur des variants rendus
/Entered on/ [2023-10-05 Thu 21:44]
* Documentation
:PROPERTIES:
:CATEGORY: doc
:END:
** DONE Procédure d'installation nix + dependences pour VM CHU
CLOSED: [2023-04-22 Sat 15:27] SCHEDULED: <2023-04-13 Thu>
* Bibliographie
** DONE Finir[cite:@alser2021]
CLOSED: [2023-09-26 Tue 11:26] SCHEDULED: <2023-09-22 Fri>
* Manuscript
:PROPERTIES:
:CATEGORY: manuscript
:END:
** DONE Flowchart pipeline (avec T2T)
CLOSED: [2023-09-17 Sun 23:15] SCHEDULED: <2023-09-17 Sun>
** Aligneur
*** DONE Figure: nombre de publication par aligneur
CLOSED: [2023-09-19 Tue 16:54] SCHEDULED: <2023-09-19 Tue>
/Entered on/ [2023-09-19 Tue 08:43]
*** DONE Biblio performance aligneur <(biblio aligneur)> <(aligneur)>
CLOSED: [2023-10-13 Fri 17:40] SCHEDULED: <2023-10-01 Sun>
*** DONE Figure: nombre d'articles citant les principaux aligneur par année
CLOSED: [2023-10-11 Wed 23:54] SCHEDULED: <2023-10-03 Tue>
Il faudrait utiliser pubmed en local, sinon c'est 10 000 requete par aligner !
*** DONE Figure: nombre d'articles citant les principaux aligneur
CLOSED: [2023-10-12 Thu 23:58] SCHEDULED: <2023-10-12 Thu>
Il faudrait utiliser pubmed en local, sinon c'est 10 000 requete par aligner !
On se base sur
** Appel de variant
*** DONE Biblio <(biblio appel variant)> <(appel variant)>
CLOSED: [2023-11-25 Sat 23:29] SCHEDULED: <2023-11-25 Sat 11:00>
*** TODO Finir biblio avec comparatifs [0/2]
SCHEDULED: <2023-11-26 Sun 13:00>
- [ ] [[file:~/research/bisonex/thesis/biblio.org::#Kumaran_2019][Performance assessment of variant calling pipelines using human whole exome sequencing and simulated data]]
- [ ] [[file:~/research/bisonex/thesis/biblio.org::*Comparaison de pipeline][Comparaison de pipeline]]
*** KILL Figure: nombre de publication par appel de variant
CLOSED: [2023-11-25 Sat 19:00] SCHEDULED: <2023-11-07 Tue>
/Entered on/ [2023-09-19 Tue 08:43]
Impossible d'utiliser pubmed car certains sont sur arxiv
** TODO Figure: nombre d'exomes par années
SCHEDULED: <2023-12-08 Fri>
/Entered on/ [2023-09-19 Tue 08:43]
* Tests :tests:
** KILL Non régression : version prod
CLOSED: [2023-05-23 Tue 08:46]
*** DONE ID common snp
CLOSED: [2022-11-19 Sat 21:36]
#+begin_src
$ wc -l ID_of_common_snp.txt
23194290 ID_of_common_snp.txt
$ wc -l /Work/Users/apraga/bisonex/database/dbSNP/ID_of_common_snp.txt
23194290 /Work/Users/apraga/bisonex/database/dbSNP/ID_of_common_snp.txt
#+end_src
*** DONE ID common snp not clinvar patho
CLOSED: [2022-12-11 Sun 20:11]
**** DONE Vérification du problème
CLOSED: [2022-12-11 Sun 16:30]
Sur le J:
21155134 /Work/Groups/bisonex/data/dbSNP/GRCh38.p13/ID_of_common_snp_not_clinvar_patho.txt.ref
Version de "non-régression"
21155076 database/dbSNP/ID_of_common_snp_not_clinvar_patho.txt
Nouvelle version
23193391 /Work/Groups/bisonex/data/dbSNP/GRCh38.p13/ID_of_common_snp_not_clinvar_patho.txt
Si on enlève les doublons
$ sort database/dbSNP/ID_of_common_snp_not_clinvar_patho.txt | uniq > old.txt
$ wc -l old.txt
21107097 old.txt
$ sort /Work

Replacement in projects/bisonex.org at line 64 [9.35]

B:BD[12.43998] → [12.43998:44121]

B:BD[12.44121] → [4.25111:33303]

∅:D[4.33303] → [13.24838:26849]

B:BD[13.24838] → [13.24838:26849]

∅:D[13.26849] → [14.23470:27177]

B:BD[14.23470] → [14.23470:27177]

∅:D[14.27177] → [7.742:3093]

B:BD[12.57375] → [7.742:3093]

P    ALL        15883     15479       404        23597      5277       2841     46     44       0.974564          0.745760 
       0.120397         0.844947                3.017198                 2.85705                   5.560099                   2.114633
  SNP   PASS        15883     15479       404        23597      5277       2841     46     44       0.974564          0.745760        0.120397         0.844947                3.017198                 2.85705                   5.560099                   2.114633
******* DONE Vérifier qu'il ne reste plus de filtre autre que PASS
CLOSED: [2023-07-08 Sat 15:19]
#+begin_src
$ zgrep -c 'PASS' HG001_GRCh38_1_22_v4_lifted_merged.vcf.gz
3730505
$ zgrep -c '^chr' HG001_GRCh38_1_22_v4_lifted_merged.vcf.gz
3730506
#+end_src
****** TODO 1/4 SNP manquant ?
******* DONE Regarder avec Julia si ce sont vraiment des FP: 61/5277 qui ne le sont pas
CLOSED: [2023-07-09 Sun 12:09]
******* DONE Examiner les FP
CLOSED: [2023-07-30 Sun 22:05]
******* DONE Tester un FP
CLOSED: [2023-07-30 Sun 22:05]
  2 │ chr1        608765  A           G           ./.:.:.:.:NOCALL:nocall:.  1/1:FP:.:ti:SNP:homalt:188
  liftDown UCSC: rien en GIAB : vrai FP
 3 │ chr1        762943  A           G           ./.:.:.:.:NOCALL:nocall:.  1/1:FP:.:ti:SNP:homalt:287
 4 │ chr1        762945  A           T           ./.:.:.:.:NOCALL:nocall:.  1/1:FP:.:tv:SNP:homalt:287
 Remaniements complexes ? Pas dans le gène en HG38
******* DONE La plupart des FP (4705/5566) sont homozygotes: erreur de référence ?
CLOSED: [2023-07-12 Wed 21:10] SCHEDULED: <2023-07-09 Sun>
Sur les 2 premiers variants, ils montrent en fait la différence entre T2T et GRCh38
Erreur à l'alignement ?
******** KILL relancer l'alignement
CLOSED: [2023-07-09 Sun 17:36]
******** DONE vérifier reads identiques hg38 et T2T: oui
CLOSED: [2023-07-09 Sun 16:36]
T2T CHR1608765
38   	chr1:1180168-1180168 (
SRR14724513.24448214
SRR14724513.24448214
******* DONE Vérifier quelques variants sur IGV
CLOSED: [2023-07-09 Sun 17:36]
******* KILL Répartition des FP : cluster ?
CLOSED: [2023-07-09 Sun 17:36]
****** DONE Examiner les FP restant après correction selon séquence de référence
CLOSED: [2023-08-12 Sat 15:57]
****** HOLD Examiner les variants supprimé
****** TODO Enlever les FP qui correspondent à un changement dans le génome
******* Condition:
- pas de variation à la position en GRCh38
- variantion homozygote
- la varation en T2T correspond au changement de pair de base GRC38 -> T2T
  pour les SNP:
  alt_T2T[i] = DNA_GRC38[j]
  avec i la position en T2T et j la position en GRCh38
  Note: définir un ID n'est pas correct car les variants peuvent être modifié par happy !
******* Idée
 - Pour chaque FP, c'est un "faux" FP si
     - REF en hg38 == ALT en T2T
     - et REF en hg38 != REF en T2T
     - et variant homozygote
Comment obtenir les séquences de réferences ?
1. liftover
2. blat sur la séquence autour du variant
3. identifier quelques reads contenant le variant et regarder leur aligneement en hg38
Après discussion avec Alexis: solution 3
******* Algorithme
1. Extraire les coordonnées en T2T des faux positifs *homozygote*
2. Pour chaque faux positif
   1. lister 10 reads contenant le variant
   2. pour chacun de ces reads, récupérer la séquence en T2T et GRCh38 via le nom du read dans le bam
   3. si la séquence en T2T modifiée par le variant est "identique" à celle en GRCh38, alors on ignore ce faux positif
Note: on ignore les reads qui ont changé de chromosome entre les version
******* DONE Résultat préliminaire
CLOSED: [2023-07-23 Sun 14:30]
cf [[file:~/roam/research/bisonex/code/giab/giab-corrected.csv][script julia]]
3498 faux positifs en moins, soit 0.89 sensibilité
julia> tp=15479
julia> fp=5277
julia> tp/(tp+fp)
0.7457602620928888
julia> tp/(tp+(fp-3498))
0.8969173716537258
On est toujours en dessous des 97%
******* HOLD Corriger proprement VCF ou résultats Happy
******* TODO Adapter pour gérer plusieurs variants par read
****** DONE Méthodologie du pangenome
CLOSED: [2023-10-03 Tue 21:28]
Voir biblio[cite:@liao2023]  mais ont aligné sur GRCH38
******* DONE Mail alexis
CLOSED: [2023-10-03 Tue 21:28]
****** DONE Méthodologie T2T
CLOSED: [2023-10-16 Mon 19:42]
Mail alexis
SCHEDULED: <2023-10-04 Wed>
***** TODO Rendre simplement le nombre de vrais positifs
SCHEDULED: <2023-12-02 Sat>
***** KILL Mail Yannis
CLOSED: [2023-07-08 Sat 10:44]
***** DONE Mail GIAB pour version T2T
CLOSED: [2023-07-07 Fri 18:37]
**** KILL HG002 :hg002:T2T:
CLOSED: [2023-11-26 Sun 12:30]
**** KILL HG003 :hg003:T2T:
CLOSED: [2023-11-26 Sun 12:30]
**** KILL HG004 :hg004:T2T:
CLOSED: [2023-11-26 Sun 12:30]
**** DONE Plot : ashkenazim trio :hg38:
CLOSED: [2023-07-30 Sun 16:49] SCHEDULED: <2023-07-30 Sun 15:00>
:LOGBOOK:
CLOCK: [2023-07-30 Sun 16:06]--[2023-07-30 Sun 16:35] =>  0:29
CLOCK: [2023-07-30 Sun 15:39]--[2023-07-30 Sun 15:40] =>  0:01
:END:
/Entered on/ [2023-04-16 Sun 17:29]
Refaire résultats
**** DONE Mail Paul sur les résultat ashkenazim +/- centogene
CLOSED: [2023-08-06 Sun 20:24] SCHEDULED: <2023-08-06 Sun>
**** DONE Relancer comparaison GIAB avec GATK 4.4.0
CLOSED: [2023-08-12 Sat 15:55]
/Entered on/ [2023-08-03 Thu 12:42]
**** TODO Re-télécharger proprement dans pipeline dédiés
[[*Résumé][Résumé]]
Cf [[*Validation : Quelles données de référence ?][Validation : Quelles données de référence ?]]
https://medium.com/dnanexus/benchmarking-state-of-the-art-secondary-variant-calling-pipelines-5472ca6bace7
Source:
https://trace.ncbi.nlm.nih.gov/Traces/index.html?view=study&acc=SRP047086
https://zenodo.org/records/3597727
Selon https://github.com/genome-in-a-bottle/giab_data_indexes
***** TODO HG001 :hg001:
SCHEDULED: <2023-11-29 Wed>
****** TODO Avec données en hg38
SCHEDULED: <2023-11-29 Wed>
[[*Résumé][Résumé]]
****** TODO Avec données en hg19
SCHEDULED: <2023-12-03 Sun>
Utiliser crossmap ! https://crossmap.readthedocs.io/en/latest/ (inspiré de [[https://github.com/bcbio/bcbio_validation_workflows/blob/master/giab-exome/input/get_data.sh][bcbio]]
pour vérifier
***** TODO HG002 :hg002:
SCHEDULED: <2023-12-04 Mon>
***** TODO HG003 :hg003:
SCHEDULED: <2023-12-04 Mon>
***** TODO HG004 :hg001:
SCHEDULED: <2023-12-04 Mon>
**** TODO Refaire les analyses pour avoir meilleurs résultats
SCHEDULED: <2023-12-03 Sun>
On veut les résultats de https://medium.com/dnanexus/benchmarking-state-of-the-art-secondary-variant-calling-pipelines-5472ca6bace7
***** TODO hap.py avec conda
SCHEDULED: <2023-12-03 Sun>
***** TODO rtgveval
SCHEDULED: <2023-12-03 Sun>
***** TODO Relancer
SCHEDULED: <2023-12-03 Sun>
*** TODO Platinum genome :platinum:
https://emea.illumina.com/platinumgenomes.html
**** TODO Tester sur la zone couverte par l'exome centogène
SCHEDULED: <2023-12-02 Sat>
*** DONE Séquencer NA12878 :cento:hg001:
CLOSED: [2023-10-07 Sat 17:59]
Discussion avec Paul : sous-traitant ne nous donnera pas les données, il faut commander l'ADN
**** DONE ADN commandé
CLOSED: [2023-06-30 Fri 22:29]
**** DONE Sauvegarder les données brutes
CLOSED: [2023-07-30 Sun 14:22] SCHEDULED: <2023-07-19 Wed>
K, scality, S
**** KILL Récupérer le fichier de capture
CLOSED: [2023-07-30 Sun 14:25] SCHEDULED: <2023-07-23 Sun>
Candidats donnés dans publication https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8354858/
#+begin_quote
In short, the Nextera Rapid Capture Exome Kit (Illumina, San Diego, CA), the SureSelect Human All Exon kit (Agilent, Santa Clara, CA) or the Twist Human Core Exome was used for enrichment, and a Nextseq500, HiSeq4000, or Novoseq 6000 (Illumina) instrument was used for the actual sequencing, with the average coverage targeted to at least 100× or at least 98% of the target DNA covered 20×.
#+end_quote
Par défaut, on utilisera https://www.twistbioscience.com/products/ngs/alliance-panels#tab-3
ANnonce récente pour nouveau panel Twist : https://www.centogene.com/news-events/news/newsdetails/twist-bioscience-and-centogene-launch-three-panels-to-advance-rare-disease-and-hereditary-cancer-research-and-support-diagnostics
Masi pas de fichier BED
***** DONE Mail centogène
CLOSED
: [2023-07-30 Sun 14:22] DEADLINE: <2023-07-23 Sun>
**** DONE Tester Nextera Rapid Capture Exome v1.2 (hg19) :giab:
CLOSED: [2023-08-06 Sun 19:05] SCHEDULED: <2023-08-03 Thu 19:00>
https://support.illumina.com/downloads/nextera-rapid-capture-exome-v1-2-product-files.html
***** DONE Liftover capture
CLOSED: [2023-08-06 Sun 18:30] SCHEDULED: <2023-08-06 Sun>
#+begin_src sh
 nextflow run -profile standard,helios workflows/lift-nextera-capture.nf  -lib lib
#+end_src
Vérification rapide : ok
***** DONE Run
CLOSED: [2023-08-06 Sun 19:05] SCHEDULED: <2023-08-06 Sun>
#+begin_src sh
 nextflow run workflows/compareVCF.nf -profile standard,helios --query=out/2300346867_NA12878-63118093_S260-GRCh38/callVariant/haplotypecaller/2300346867_NA12878-63118093_S260-GRCh38.vcf.gz --outdir=out/2300346867_NA12878-63118093_S260-GRCh38/happy-nextera-lifted/ --compare=happy -lib lib --capture=capture/nexterarapidcapture_exome_targetedregions_v1.2-nochrM_lifted.bed  --id=HG001 --genome=GRCh38
#+end_src
**** DONE Tester Agilent SureSelect All Exon V8 (hg38) :giab:
CLOSED: [2023-07-31 Mon 23:09] SCHEDULED: <2023-07-31 Mon>
https://earray.chem.agilent.com/suredesign/index.htm
"Find design"
"Agilent catalog"
Fichiers:
- Regions.bed: Targeted exon intervals, curated and targeted by Agilent Technologies
- MergedProbes.bed: Merged probes for targeted enrichment of exons described in Regions.bed
- Covered.bed: Merged probes and sequences with 95% homology or above
- Padded.bed: Merged probes and sequences with 95% homology or above extended 50 bp at each side
- AllTracks.bed: Targeted regions and covered tracks
 #+begin_src sh
nextflow run workflows/compareVCF.nf -profile standard,helios --query=out/2300346867_63118093_NA12878-GRCh38/callVariant/haplotypecaller/2300346867_63118093_NA12878-GRCh38.vcf.gz --outdir=out/2300346867_63118093_NA12878-GRCh38/happy/ --compare=happy -lib lib --capture=capture/Agilent_SureSelect_All_Exons_v8_hg38_Regions.bed  --id=HG001 --genome=GRCh38
 #+e
nd_src
| Type  | Filter | TRUTH.TOTAL | TRUTH.TP | TRUTH.FN | QUERY.TOTAL | QUERY.FP | QUERY.UNK | FP.gt | FP.al | METRIC.Recall | METRIC.Precision | METRIC.Frac_NA | METRIC.F1_Score | TRUTH.TOTAL.TiTv_ratio | QUERY.TOTAL.TiTv_ratio | TRUTH.TOTAL.het_hom_ratio | QUERY.TOTAL.het_hom_ratio |
| INDEL | ALL    |         423 |      395 |       28 |         915 |      108 |       405 |     4 |    13 |      0.933806 |         0.788235 |       0.442623 |        0.854868 |                        |                        |        1.7012987012987013 |        2.7916666666666665 |
| INDEL | PASS   |         423 |      395 |       28 |         915 |      108 |       405 |     4 |    13 |      0.933806 |         0.788235 |       0.442623 |        0.854868 |                        |                        |        1.7012987012987013 |        2.7916666666666665 |
| SNP   | ALL    |       20984 |    20600 |      384 |       26080 |      780 |      4703 |    62 |    10 |        0.9817 |         0.963512 |        0.18033 |        0.972521 |     3.0499710592321048 |     2.7596541786743516 |          1.58256372367935 |        1.8978207694018234 |
| SNP   | PASS   |       20984 |    20600 |      384 |       26080 |      780 |      4703 |    62 |    10 |        0.9817 |         0.963512 |        0.18033 |        0.972521 |     3.0499710592321048 |     2.7596541786743516 |          1.58256372367935 |        1.8978207694018234 |
**** DONE Test Twist Human core Exome (hg38):giab:
CLOSED: [2023-08-01 Tue 23:16] SCHEDULED: <202 3-08-02 Wed>
https://www.twistbioscience.com/resources/data-files/ngs-human-core-exome-panel-bed-file
#+begin_src
nextflow run workflows/compareVCF.nf -profile standard,helios --query=out/2300346867_63118093_NA12878-GRCh38/callVariant/haplotypecaller/2300346867_63118093_NA12878-GRCh38.vcf.gz --outdir=out/2300346867_63118093_NA12878-GRCh38/happy-twist-exome-core/ --compare=happy -lib lib --capture=capture/Twist_Exome_Core_Covered_Targets_hg38.bed  --id=HG001 --genome=GRCh38 -bg
#+end_src
| Type  | Filter | TRUTH.TOTAL | TRUTH.TP | TRUTH.FN | QUERY.TOTAL | QUERY.FP | QUERY.UNK | FP.gt | FP.al | METRIC.Recall | METRIC.Precision | METRIC.Frac_NA | METRIC.F1_Score | TRUTH.TOTAL.TiTv_ratio | QUERY.TOTAL.TiTv_ratio | TRUTH.TOTAL.het_hom_ratio | QUERY.TOTAL.het_hom_ratio |
| INDEL | ALL    |         328 |      313 |       15 |         722 |       95 |       309 |     4 |    13 |      0.954268 |         0.769976 |       0.427978 |        0.852273 |                        |                        |        1.8584070796460177 |        2.8967391304347827 |
| INDEL | PASS   |         328 |      313 |       15 |         722 |       95 |       309 |     4 |    13 |      0.954268 |         0.769976 |       0.427978 |        0.852273 |                        |                        |        1.8584070796460177 |        2.8967391304347827 |
| SNP   | ALL    |       19198 |    18962 |      236 |       23381 |      684 |      3738 |    48 |    10 |      0.987707 |         0.965178 |       0.159873 |        0.976313 |     3.1034188034188035 |      2.859264147830391 |        1.5669565217391304 |        1.8578767123287672 |
| SNP   | PASS   |       19198 |    18962 |      236 |       23381 |      684 |      3738 |    48 |    10 |      0.987707 |         0.965178 |       0.159873 |        0.976313 |     3.1034188034188035 |      2.859264147830391 |        1.5669565217391304 |        1.8578767123287672 |
**** DONE Test Twist Human core Exome (hg38):giab:
CLOSED: [2023-08-05 Sat 09:25] SCHEDULED: <2023-08-03 Thu 20:00>
#+begin_src sh
ID="2300346867_NA12878-63118093_S260-GRCh38"; nextflow run workflows/compareVCF.nf -profile standard,helios --q
uery=out/${ID}/callVariant/haplotypecaller/${ID}.vcf.gz --outdir=out/${ID}/happy-twist-exome-core/ --compare=happy -lib lib --capture=capture/Twist_Exome_Core_Covered_Targets_hg38.bed  --id=HG001 --genome=GRCh38 -bg
#+end_src
**** DONE Tester Agilen SureSelect All Exon V8 (hg38) GATK-4.4:giab:
CLOSED: [2023-08-05 Sat 09:25] SCHEDULED: <2023-08-03 Thu 20:00>
**** DONE Vérifier l'impact gatk 4.3 - 4.4 : aucun
CLOSED: [2023-08-05 Sat 09:25]
**** DONE Figure comparant les 3 capture :hg001:
CLOSED: [2023-08-06 Sun 20:24] SCHEDULED: <2023-08-06 Sun>
**** DONE Mail Paul sur  les 3 capture :hg001:
CLOSED: [2023-08-06 Sun 20:24] SCHEDULED: <2023-08-06 Sun>
**** KILL Tester si le panel Twist Alliance VCGS Exome suffit
CLOSED: [2023-07-31 Mon 22:31] SCHEDULED: <2023-07-30 Sun>
**** DONE Mail cento pour demande le type de capture
CLOSED: [2023-10-07 Sat 17:59]
/Entered on/ [2023-08-07 Mon 20:40]
Twist exome
*** PROJ Comparer happy et happy-vcfeval :giab:
** TODO Données syndip (CHM-eval) ! :syndip:
https://github.com/lh3/CHM-eval
*** KILL Données officielles : non car génome !!
CLOSED: [2023-11-19 Sun 23:43]
**** KILL Run ERR1341793
CLOSED: [2023-11-19 Sun 23:43] SCHEDULED: <2023-11-18 Sat>
(raw reads ERR1341793_1.fastq.gz and ERR1341793_2.fastq.gz downloaded from https://www.ebi.ac.uk/ena/browser/view/ERR1341793)
**** KILL Run ERR1341796
CLOSED: [2023-11-19 Sun 23:43] SCHEDULED: <2023-11-18 Sat>
*** TODO Données exome Broad institute (nextflow)
SCHEDULED: <2023-12-03 Sun>
https://console.cloud.google.com/storage/browser/broad-public-datasets/CHM1_CHM13_WES;tab=objects?pli=1&prefix=&forceOnObjectsSortingFiltering=false
*** TODO Télécharger VCF
SCHEDULED: <2023-12-01 Fri>
https://github.com/lh3/CHM-eval/releases
** TODO Insilico :cento:
*** TODO tous les variants centogène
**** DONE Extraire liste des SNVs
CLOSED: [2023-04-22 Sat 17:32] SCHEDULED: <2023-04-17 Mon>
***** DONE Corriger manquant à la main
CLOSED: [2023-04-22 Sat 17:31]
La sortie est sauvegardé dans git-annex : variants_success.csv
***** DONE Automatique
CLOSED: [2023-04-22 Sat 17:31]
**** DONE Convert SNVs : transcript -> génomique
CLOSED: [2023-06-03 Sat 17:16]
***** DONE Variant_recoder
CLOSED: [2023-04-26 Wed 21:21] SCHEDULED: <2023-04-22 Sat>
****** KILL Haskell: 160 manquant : recoded-success.csv
C

[12.43998]

[7.3093]

P    ALL        15883     15479       404        23597      5277       2841     46     44       0.974564          0.745760        0.120397         0.844947                3.017198                 2.85705                   5.560099                   2.114633
  SNP   PASS        15883     15479       404        23597      5277       2841     46     44       0.974564          0.745760        0.120397         0.844947                3.017198                 2.85705                   5.560099                   2.114633
******* DONE Vérifier qu'il ne reste plus de filtre autre que PASS
CLOSED: [2023-07-08 Sat 15:19]
#+begin_src
$ zgrep -c 'PASS' HG001_GRCh38_1_22_v4_lifted_merged.vcf.gz
3730505
$ zgrep -c '^chr' HG001_GRCh38_1_22_v4_lifted_merged.vcf.gz
3730506
#+end_src
****** TODO 1/4 SNP manquant ?
******* DONE Regarder avec Julia si ce sont vraiment des FP: 61/5277 qui ne le sont pas
CLOSED: [2023-07-09 Sun 12:09]
******* DONE Examiner les FP
CLOSED: [2023-07-30 Sun 22:05]
******* DONE Tester un FP
CLOSED: [2023-07-30 Sun 22:05]
  2 │ chr1        608765  A           G           ./.:.:.:.:NOCALL:nocall:.  1/1:FP:.:ti:SNP:homalt:188
  liftDown UCSC: rien en GIAB : vrai FP
 3 │ chr1        762943  A           G           ./.:.:.:.:NOCALL:nocall:.  1/1:FP:.:ti:SNP:homalt:287
 4 │ chr1        762945  A           T           ./.:.:.:.:NOCALL:nocall:.  1/1:FP:.:tv:SNP:homalt:287
 Remaniements complexes ? Pas dans le gène en HG38
******* DONE La plupart des FP (4705/5566) sont homozygotes: erreur de référence ?
CLOSED: [2023-07-12 Wed 21:10] SCHEDULED: <2023-07-09 Sun>
Sur les 2 premiers variants, ils montrent en fait la différence entre T2T et GRCh38
Erreur à l'alignement ?
******** KILL relancer l'alignement
CLOSED: [2023-07-09 Sun 17:36]
******** DONE vérifier reads identiques hg38 et T2T: oui
CLOSED: [2023-07-09 Sun 16:36]
T2T CHR1608765
38   	chr1:1180168-1180168 (
SRR14724513.24448214
SRR14724513.24448214
******* DONE Vérifier quelques variants sur IGV
CLOSED: [2023-07-09 Sun 17:36]
******* KILL Répartition des FP : cluster ?
CLOSED: [2023-07-09 Sun 17:36]
****** DONE Examiner les FP restant après correction selon séquence de référence
CLOSED: [2023-08-12 Sat 15:57]
****** HOLD Examiner les variants supprimé
****** TODO Enlever les FP qui correspondent à un changement dans le génome
******* Condition:
- pas de variation à la position en GRCh38
- variantion homozygote
- la varation en T2T correspond au changement de pair de base GRC38 -> T2T
  pour les SNP:
  alt_T2T[i] = DNA_GRC38[j]
  avec i la position en T2T et j la position en GRCh38
  Note: définir un ID n'est pas correct car les variants peuvent être modifié par happy !
******* Idée
 - Pour chaque FP, c'est un "faux" FP si
     - REF en hg38 == ALT en T2T
     - et REF en hg38 != REF en T2T
     - et variant homozygote
Comment obtenir les séquences de réferences ?
1. liftover
2. blat sur la séquence autour du variant
3. identifier quelques reads contenant le variant et regarder leur aligneement en hg38
Après discussion avec Alexis: solution 3
******* Algorithme
1. Extraire les coordonnées en T2T des faux positifs *homozygote*
2. Pour chaque faux positif
   1. lister 10 reads contenant le variant
   2. pour chacun de ces reads, récupérer la séquence en T2T et GRCh38 via le nom du read dans le bam
   3. si la séquence en T2T modifiée par le variant est "identique" à celle en GRCh38, alors on ignore ce faux positif
Note: on ignore les reads qui ont changé de chromosome entre les version
******* DONE Résultat préliminaire
CLOSED: [2023-07-23 Sun 14:30]
cf [[file:~/roam/research/bisonex/code/giab/giab-corrected.csv][script julia]]
3498 faux positifs en moins, soit 0.89 sensibilité
julia> tp=15479
julia> fp=5277
julia> tp/(tp+fp)
0.7457602620928888
julia> tp/(tp+(fp-3498))
0.8969173716537258
On est toujours en dessous des 97%
******* HOLD Corriger proprement VCF ou résultats Happy
******* TODO Adapter pour gérer plusieurs variants par read
****** DONE Méthodologie du pangenome
CLOSED: [2023-10-03 Tue 21:28]
Voir biblio[cite:@liao2023]  mais ont aligné sur GRCH38
******* DONE Mail alexis
CLOSED: [2023-10-03 Tue 21:28]
****** DONE Méthodologie T2T
CLOSED: [2023-10-16 Mon 19:42]
Mail alexis
SCHEDULED: <2023-10-04 Wed>
***** TODO Rendre simplement le nombre de vrais positifs
SCHEDULED: <2023-12-08 Fri>
***** KILL Mail Yannis
CLOSED: [2023-07-08 Sat 10:44]
***** DONE Mail GIAB pour version T2T
CLOSED: [2023-07-07 Fri 18:37]
**** KILL HG002 :hg002:T2T:
CLOSED: [2023-11-26 Sun 12:30]
**** KILL HG003 :hg003:T2T:
CLOSED: [2023-11-26 Sun 12:30]
**** KILL HG004 :hg004:T2T:
CLOSED: [2023-11-26 Sun 12:30]
**** DONE Plot : ashkenazim trio :hg38:
CLOSED: [2023-07-30 Sun 16:49] SCHEDULED: <2023-07-30 Sun 15:00>
:LOGBOOK:
CLOCK: [2023-07-30 Sun 16:06]--[2023-07-30 Sun 16:35] =>  0:29
CLOCK: [2023-07-30 Sun 15:39]--[2023-07-30 Sun 15:40] =>  0:01
:END:
/Entered on/ [2023-04-16 Sun 17:29]
Refaire résultats
**** DONE Mail Paul sur les résultat ashkenazim +/- centogene
CLOSED: [2023-08-06 Sun 20:24] SCHEDULED: <2023-08-06 Sun>
**** DONE Relancer comparaison GIAB avec GATK 4.4.0
CLOSED: [2023-08-12 Sat 15:55]
/Entered on/ [2023-08-03 Thu 12:42]
**** TODO Re-télécharger proprement dans pipeline dédiés
[[*Résumé][Résumé]]
Cf [[*Validation : Quelles données de référence ?][Validation : Quelles données de référence ?]]
https://medium.com/dnanexus/benchmarking-state-of-the-art-secondary-variant-calling-pipelines-5472ca6bace7
Source:
https://trace.ncbi.nlm.nih.gov/Traces/index.html?view=study&acc=SRP047086
https://zenodo.org/records/3597727
Selon https://github.com/genome-in-a-bottle/giab_data_indexes
***** TODO HG001 :hg001:
SCHEDULED: <2023-11-29 Wed>
****** TODO Avec données en hg38
SCHEDULED: <2023-11-29 Wed>
[[*Résumé][Résumé]]
****** TODO Avec données en hg19
SCHEDULED: <2023-12-10 Sun>
Utiliser crossmap ! https://crossmap.readthedocs.io/en/latest/ (inspiré de [[https://github.com/bcbio/bcbio_validation_workflows/blob/master/giab-exome/input/get_data.sh][bcbio]]
pour vérifier
***** TODO HG002 :hg002:
SCHEDULED: <2023-12-04 Mon>
***** TODO HG003 :hg003:
SCHEDULED: <2023-12-04 Mon>
***** TODO HG004 :hg001:
SCHEDULED: <2023-12-04 Mon>
**** TODO Refaire les analyses pour avoir meilleurs résultats
SCHEDULED: <2023-12-03 Sun>
On veut les résultats de https://medium.com/dnanexus/benchmarking-state-of-the-art-secondary-variant-calling-pipelines-5472ca6bace7
***** TODO hap.py avec conda
SCHEDULED: <2023-12-10 Sun>
***** TODO rtgveval
SCHEDULED: <2023-12-10 Sun>
***** TODO Relancer
SCHEDULED: <2023-12-10 Sun>
*** TODO Platinum genome :platinum:
https://emea.illumina.com/platinumgenomes.html
**** TODO Tester sur la zone couverte par l'exome centogène
SCHEDULED: <2023-12-08 Fri>
*** DONE Séquencer NA12878 :cento:hg001:
CLOSED: [2023-10-07 Sat 17:59]
Discussion avec Paul : sous-traitant ne nous donnera pas les données, il faut commander l'ADN
**** DONE ADN commandé
CLOSED: [2023-06-30 Fri 22:29]
**** DONE Sauvegarder les données brutes
CLOSED: [2023-07-30 Sun 14:22] SCHEDULED: <2023-07-19 Wed>
K, scality, S
**** KILL Récupérer le fichier de capture
CLOSED: [2023-07-30 Sun 14:25] SCHEDULED: <2023-07-23 Sun>
Candidats donnés dans publication https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8354858/
#+begin_quote
In short, the Nextera Rapid Capture Exome Kit (Illumina, San Diego, CA), the SureSelect Human All Exon kit (Agilent, Santa Clara, CA) or the Twist Human Core Exome was used for enrichment, and a Nextseq500, HiSeq4000, or Novoseq 6000 (Illumina) instrument was used for the actual sequencing, with the average coverage targeted to at least 100× or at least 98% of the target DNA covered 20×.
#+end_quote
Par défaut, on utilisera https://www.twistbioscience.com/products/ngs/alliance-panels#tab-3
ANnonce récente pour nouveau panel Twist : https://www.centogene.com/news-events/news/newsdetails/twist-bioscience-and-centogene-launch-three-panels-to-advance-rare-disease-and-hereditary-cancer-research-and-support-diagnostics
Masi pas de fichier BED
***** DONE Mail centogène
CLOSED: [2023-07-30 Sun 14:22] DEADLINE: <2023-07-23 Sun>
**** DONE Tester Nextera Rapid Capture Exome v1.2 (hg19) :giab:
CLOSED: [2023-08-06 Sun 19:05] SCHEDULED: <2023-08-03 Thu 19:00>
https://support.illumina.com/downloads/nextera-rapid-capture-exome-v1-2-product-files.html
***** DONE Liftover capture
CLOSED: [2023-08-06 Sun 18:30] SCHEDULED: <2023-08-06 Sun>
#+begin_src sh
 nextflow run -profile standard,helios workflows/lift-nextera-capture.nf  -lib lib
#+end_src
Vérification rapide : ok
***** DONE Run
CLOSED: [2023-08-06 Sun 19:05] SCHEDULED: <2023-08-06 Sun>
#+begin_src sh
 nextflow run workflows/compareVCF.nf -profile standard,helios --query=out/2300346867_NA12878-63118093_S260-GRCh38/callVariant/haplotypecaller/2300346867_NA12878-63118093_S260-GRCh38.vcf.gz --outdir=out/2300346867_NA12878-63118093_S260-GRCh38/happy-nextera-lifted/ --compare=happy -lib lib --capture=capture/nexterarapidcapture_exome_targetedregions_v1.2-nochrM_lifted.bed  --id=HG001 --genome=GRCh38
#+end_src
**** DONE Tester Agilent SureSelect All Exon V8 (hg38) :giab:
CLOSED: [2023-07-31 Mon 23:09] SCHEDULED: <2023-07-31 Mon>
https://earray.chem.agilent.com/suredesign/index.htm
"Find design"
"Agilent catalog"
Fichiers:
- Regions.bed: Targeted exon intervals, curated and targeted by Agilent Technologies
- MergedProbes.bed: Merged probes for targeted enrichment of exons described in Regions.bed
- Covered.bed: Merged probes and sequences with 95% homology or above
- Padded.bed: Merged probes and sequences with 95% homology or above extended 50 bp at each side
- AllTracks.bed: Targeted regions and covered tracks
 #+begin_src sh
nextflow run workflows/compareVCF.nf -profile standard,helios --query=out/2300346867_63118093_NA12878-GRCh38/callVariant/haplotypecaller/2300346867_63118093_NA12878-GRCh38.vcf.gz --outdir=out/2300346867_63118093_NA12878-GRCh38/happy/ --compare=happy -lib lib --capture=capture/Agilent_SureSelect_All_Exons_v8_hg38_Regions.bed  --id=HG001 --genome=GRCh38
 #+end_src
| Type  | Filter | TRUTH.TOTAL | TRUTH.TP | TRUTH.FN | QUERY.TOTAL | QUERY.FP | QUERY.UNK | FP.gt | FP.al | METRIC.Recall | METRIC.Precision | METRIC.Frac_NA | METRIC.F1_Score | TRUTH.TOTAL.TiTv_ratio | QUERY.TOTAL.TiTv_ratio | TRUTH.TOTAL.het_hom_ratio | QUERY.TOTAL.het_hom_ratio |
| INDEL | ALL    |         423 |      395 |       28 |         915 |      108 |       405 |     4 |    13 |      0.933806 |         0.788235 |       0.442623 |        0.854868 |                        |                        |        1.7012987012987013 |        2.7916666666666665 |
| INDEL | PASS   |         423 |      395 |       28 |         915 |      108 |       405 |     4 |    13 |      0.933806 |         0.788235 |       0.442623 |        0.854868 |                        |                        |        1.7012987012987013 |        2.7916666666666665 |
| SNP   | ALL    |       20984 |    20600 |      384 |       26080 |      780 |      4703 |    62 |    10 |        0.9817 |         0.963512 |        0.18033 |        0.972521 |     3.0499710592321048 |     2.7596541786743516 |          1.58256372367935 |        1.8978207694018234 |
| SNP   | PASS   |       20984 |    20600 |      384 |       26080 |      780 |      4703 |    62 |    10 |        0.9817 |         0.963512 |        0.18033 |        0.972521 |     3.0499710592321048 |     2.7596541786743516 |          1.58256372367935 |        1.8978207694018234 |
**** DONE Test Twist Human core Exome (hg38):giab:
CLOSED: [2023-08-01 Tue 23:16] SCHEDULED: <202 3-08-02 Wed>
https://www.twistbioscience.com/resources/data-files/ngs-human-core-exome-panel-bed-file
#+begin_src
nextflow run workflows/compareVCF.nf -profile standard,helios --query=out/2300346867_63118093_NA12878-GRCh38/callVariant/haplotypecaller/2300346867_63118093_NA12878-GRCh38.vcf.gz --outdir=out/2300346867_63118093_NA12878-GRCh38/happy-twist-exome-core/ --compare=happy -lib lib --capture=capture/Twist_Exome_Core_Covered_Targets_hg38.bed  --id=HG001 --genome=GRCh38 -bg
#+end_src
| Type  | Filter | TRUTH.TOTAL | TRUTH.TP | TRUTH.FN | QUERY.TOTAL | QUERY.FP | QUERY.UNK | FP.gt | FP.al | METRIC.Recall | METRIC.Precision | METRIC.Frac_NA | METRIC.F1_Score | TRUTH.TOTAL.TiTv_ratio | QUERY.TOTAL.TiTv_ratio | TRUTH.TOTAL.het_hom_ratio | QUERY.TOTAL.het_hom_ratio |
| INDEL | ALL    |         328 |      313 |       15 |         722 |       95 |       309 |     4 |    13 |      0.954268 |         0.769976 |       0.427978 |        0.852273 |                        |                        |        1.8584070796460177 |        2.8967391304347827 |
| INDEL | PASS   |         328 |      313 |       15 |         722 |       95 |       309 |     4 |    13 |      0.954268 |         0.769976 |       0.427978 |        0.852273 |                        |                        |        1.8584070796460177 |        2.8967391304347827 |
| SNP   | ALL    |       19198 |    18962 |      236 |       23381 |      684 |      3738 |    48 |    10 |      0.987707 |         0.965178 |       0.159873 |        0.976313 |     3.1034188034188035 |      2.859264147830391 |        1.5669565217391304 |        1.8578767123287672 |
| SNP   | PASS   |       19198 |    18962 |      236 |       23381 |      684 |      3738 |    48 |    10 |      0.987707 |         0.965178 |       0.159873 |        0.976313 |     3.1034188034188035 |      2.859264147830391 |        1.5669565217391304 |        1.8578767123287672 |
**** DONE Test Twist Human core Exome (hg38):giab:
CLOSED: [2023-08-05 Sat 09:25] SCHEDULED: <2023-08-03 Thu 20:00>
#+begin_src sh
ID="2300346867_NA12878-63118093_S260-GRCh38"; nextflow run workflows/compareVCF.nf -profile standard,helios --query=out/${ID}/callVariant/haplotypecaller/${ID}.vcf.gz --outdir=out/${ID}/happy-twist-exome-core/ --compare=happy -lib lib --capture=capture/Twist_Exome_Core_Covered_Targets_hg38.bed  --id=HG001 --genome=GRCh38 -bg
#+end_src
**** DONE Tester Agilen SureSelect All Exon V8 (hg38) GATK-4.4:giab:
CLOSED: [2023-08-05 Sat 09:25] SCHEDULED: <2023-08-03 Thu 20:00>
**** DONE Vérifier l'impact gatk 4.3 - 4.4 : aucun
CLOSED: [2023-08-05 Sat 09:25]
**** DONE Figure comparant les 3 capture :hg001:
CLOSED: [2023-08-06 Sun 20:24] SCHEDULED: <2023-08-06 Sun>
**** DONE Mail Paul sur  les 3 capture :hg001:
CLOSED: [2023-08-06 Sun 20:24] SCHEDULED: <2023-08-06 Sun>
**** KILL Tester si le panel Twist Alliance VCGS Exome suffit
CLOSED: [2023-07-31 Mon 22:31] SCHEDULED: <2023-07-30 Sun>
**** DONE Mail cento pour demande le type de capture
CLOSED: [2023-10-07 Sat 17:59]
/Entered on/ [2023-08-07 Mon 20:40]
Twist exome
*** PROJ Comparer happy et happy-vcfeval :giab:
** TODO Données syndip (CHM-eval) ! :syndip:
https://github.com/lh3/CHM-eval
*** KILL Données officielles : non car génome !!
CLOSED: [2023-11-19 Sun 23:43]
**** KILL Run ERR1341793
CLOSED: [2023-11-19 Sun 23:43] SCHEDULED: <2023-11-18 Sat>
(raw reads ERR1341793_1.fastq.gz and ERR1341793_2.fastq.gz downloaded from https://www.ebi.ac.uk/ena/browser/view/ERR1341793)
**** KILL Run ERR1341796
CLOSED: [2023-11-19 Sun 23:43] SCHEDULED: <2023-11-18 Sat>
*** TODO Données exome Broad institute (nextflow)
SCHEDULED: <2023-12-10 Sun>
https://console.cloud.google.com/storage/browser/broad-public-datasets/CHM1_CHM13_WES;tab=objects?pli=1&prefix=&forceOnObjectsSortingFiltering=false
*** TODO Télécharger VCF
SCHEDULED: <2023-12-01 Fri>
https://github.com/lh3/CHM-eval/releases
** TODO Insilico :cento:
*** TODO tous les variants centogène
**** DONE Extraire liste des SNVs
CLOSED: [2023-04-22 Sat 17:32] SCHEDULED: <2023-04-17 Mon>
***** DONE Corriger manquant à la main
CLOSED: [2023-04-22 Sat 17:31]
La sortie est sauvegardé dans git-annex : variants_success.csv
***** DONE Automatique
CLOSED: [2023-04-22 Sat 17:31]
**** DONE Convert SNVs : transcript -> génomique
CLOSED: [2023-06-03 Sat 17:16]
***** DONE Variant_recoder
CLOSED: [2023-04-26 Wed 21:21] SCHEDULED: <2023-04-22 Sat>
****** KILL Haskell: 160 manquant : recoded-success.csv
C

Replacement in projects/bisonex.org at line 78 [9.35]

B:BD[15.44924] → [15.44924:45233]

B:BD[15.45233] → [16.25486:26974]

B:BD[16.26974] → [10.37534:42604]

B:BD[10.42604] → [12.66600:67925]

0       0.0         18
   7 │ chr17     10296150  T        A        chr17:g.10296150T>A   60.0       0.0          3
   8 │ chr17     61968202  A        C        chr17:g.61968202A>C   60.0       0.0         46
   9 │ chr21     43426167  C        T        chr21:g.43426167C>T    0.0       0.0         8
8
  10 │ chrX     124056226  T        G        chrX:g.124056226T>G   60.0       0.0         40
  11 │ chrX      24737739  G        T        chrX:g.24737739G>T    60.0       0.0         16
  12 │ chrX      40591349  C        T        chrX:g.40591349C>T    60.0       0.0         37
  13 │ chrX      53193275  G        A        chrX:g.53193275G>A    60.0       0.0         32
 Le filtre est sur DP (read depth) et non la profondeur. Sur 1 et 3, DP=29 et 28...
 Si on est hétérozygote, le DP est la moitié de la profondeur donc c'est logique...
***** DONE Résultat après filter polymorphism : idem
CLOSED: [2023-08-16 Wed 20:18]
***** Résultat après filtre VEP
**** KILL [#B] Tout insérer dans NA12878 avec XAMscissors: reads manquants
CLOSED: [2023-08-19 Sat 20:04] SCHEDULED: <2023-08-14 Mon>
***** KILL Insertion
CLOSED: [2023-08-19 Sat 20:03]
On récupère le BAM
#+begin_src sh :dir /home/alex/code/bisonex/out
rsync -avz  meso:/Work/Users/apraga/bisonex/out/2300346867_NA12878-63118093_S260-GRCh38/preprocessing/mapped 2300346867_NA12878-63118093_S260-GRCh38/preprocessing/
#+end_src
#+begin_src sh :dir /home/alex/roam/research/bisonex/code/sanger
julia --project=.. xamscissors.jl
cd out-all
mv inserted_1.fq.gz NA12878-sanger-inserted-all_1.fq.gz
mv inserted_2.fq.gz NA12878-sanger-inserted-all_2.fq.gz
rsync -avz NA12878-sanger-inserted_* meso:/Work/Users/apraga/bisonex/data/
#+end_src
Fichier de configuration
patient,sample,fa
stq1,fastq2
NA12878,sanger-all,data/NA12878-sanger-inserted-all_1.fq.gz,data/NA12878-sanger-inserted-all_2.fq.gz
On lance la simulation
#+begin_src
nextflow run main.nf -profile standard,helios --input=samples-synthetic.csv --genome=GRCh38  -bg
#+end_src
***** DONE Résultat après haplotyecaller: 3 varinat perdus => ok
CLOSED: [2023-08-17 Thu 19:13]
Haplotypecaller 143 found over 146
3×3 DataFrame
| variant             | meanQual | depth |
|---------------------+----------+-------|
| chr12:g.13720138C>T |     60.0 |     1 |
| chr17:g.10296150T>A |     60.0 |     3 |
| chr21:g.43426167C>T |      0.0 |    88 |
Pas assez de read (1,2) et problème d'alignement (3)
***** KILL Résultat après filtre depth : +10 variants perduis
CLOSED: [2023-08-19 Sat 20:04] SCHEDULED: <2023-08-18 Fri>
filter depth : another 10 missed variants
10×3 DataFrame
| variant             | meanQual | depth |
|---------------------+----------+-------|
| chr3:g.71112628C>T  |     60.0 |    62 |
| chr12:g.40367710A>G |  58.0435 |    46 |
| chr14:g.58458545G>A |     60.0 |     9 |
| chr15:g.66703292C>T |     60.0 |    33 |
| chr16:g.30965737C>A |     60.0 |    18 |
| chr17:g.61968202A>C |     60.0 |    46 |
| chrX:g.124056226T>G |     60.0 |    40 |
| chrX:g.24737739G>T  |     60.0 |    16 |
| chrX:g.40591349C>T  |     60.0 |    37 |
| chrX:g.53193275G>A  |     60.0 |    32 |
|                     |          |       |
S'ils sont hétérozygotes, 0.5*depth est effectivement < 30 (notre filtre...)
****** KILL Problème d'inserstion des reads: on en perd de nombreux ! -> regénérer données
CLOSED: [2023-08-19 Sat 20:04] SCHEDULED: <2023-08-18 Fri>
Ex: chrX:g.124056226T>G : on passe de 65 reads à 1
***** DONE Résultat après filtre common variant: +0 ok
CLOSED: [2023-08-17 Thu 19:32]
***** KILL Résultat après filtre VEP : +23 perdus ??
CLOSED: [2023-08-19 Sat 20:04] SCHEDULED: <2023-08-18 Fri>
filter vep : another 23 missed variants
23×3 DataFrame
 Row │ variant               meanQual  depth
     │ String                Float64   Int64
─────┼───────────────────────────────────────
   1 │ chr1:g.183222115C>T    60.0       168
   2 │ chr1:g.39388062C>T     60.0       285
   3 │ chr2:g.240719197G>C    60.0        77
   4 │ chr3:g.41227353G>C     60.0       105
   5 │ chr4:g.15536991T>G     60.0        41
   6 │ chr5:g.14474096G>A     60.0       191
   7 │ chr8:g.43122149C>T     60.0       237
   8 │ chr9:g.128603589A>C    60.0       304
   9 │ chr9:g.137452819G>C    60.0       107
  10 │ chr10:g.129957338T>C   60.0       116
  11 │ chr10:g.247389T>G      60.0        56
  12 │ chr11:g.61313668G>A    60.0        83
  13 │ chr12:g.45850467C>T    60.0       291
  14 │ chr14:g.64216315C>G    60.0       263
  15 │ chr15:g.60514655G>A    60.0       259
  16 │ chr17:g.61966475G>T    60.0       144
  17 │ chr17:g.7852503T>C     60.0       190
  18 │ chr19:g.13230158G>A    60.0       172
  19 │ chr19:g.38523211C>G    60.0        93
  20 │ chr19:g.4110557G>C     59.9929    425
  21 │ chr20:g.62334188G>A    60.0        62
  22 │ chrX:g.47575255G>A     60.0       244
  23 │ chrX:g.53409112G>A     60.0       136
**** DONE [#A] Tout insérer dans NA12878 avec XAMscissors (XAMScissors à jour)
CLOSED: [2023-08-20 Sun 13:45] SCHEDULED: <2023-08-19 Sat>
***** DONE Insertion
CLOSED: [2023-08-20 Sun 09:15]
***** DONE Vérifier après haplotypecaller: 3 variants manquant mais ok
CLOSED: [2023-08-20 Sun 09:18] SCHEDULED: <2023-08-20 Sun>
3×3 DataFrame
 Row │ variant              meanQual  depth
     │ String               Float64   Int64
─────┼──────────────────────────────────────
   1 │ chr12:g.13720138C>T      60.0      1
   2 │ chr17:g.10296150T>A      60.0      1
   3 │ chr21:g.43426167C>T       0.0     59
Manque de profondeur sur 2 et mauvaise qualité sur 3
***** DONE Vérifier après filterdepth: 0 perdus en plus
CLOSED: [2023-08-20 Sun 09:18] SCHEDULED: <2023-08-20 Sun>
***** DONE Vérifier après filterpolymorphis : 0 perdus en plus
CLOSED: [2023-08-20 Sun 09:18] SCHEDULED: <2023-08-20 Sun>
***** DONE Vérifier après filter vep: 2 perdus en plus
CLOSED: [2023-08-20 Sun 12:37] SCHEDULED: <2023-08-20 Sun>
2×3 DataFrame
 Row │ variant             meanQual  depth
     │ String              Float64   Int64
─────┼─────────────────────────────────────
   1 │ chr17:g.7852503T>C      60.0     96
   2 │ chrX:g.47575255G>A      60.0    145
***** DONE 1ere correction spip: meilleur nombre de variants en sortie mais manque toujours ces 2
CLOSED: [2023-08-20 Sun 11:38]
***** DONE --pick : résout le problème
CLOSED: [2023-08-20 Sun 12:37]
chrX:g.47575255G>A est rendu downstream_gene_variant avec 
l'option --pick
Or il n'est pas en5' dans les transcrits refseq...
https://genome-euro.ucsc.edu/cgi-bin/hgTracks?db=hg38&lastVirtModeType=default&lastVirtModeExtraState=&virtModeType=default&virtMode=0&nonVirtPosition=&position=chrX%3A47575242%2D47575268&hgsid=301211823_xpelPqPJije7wSIhg070JeGH5ZwV
https://mobidetails.iurc.montp.inserm.fr/MD/api/variant/238296/browser/
Idem pour l'autre
   chr17:g.7852503T>C
https://mobidetails.iurc.montp.inserm.fr/MD/api/variant/182993/browser/
Note:
VEP chooses one block of annotation per variant, using an ordered set of criteria. This order may be customised using --pick_order.
    MANE Select transcript status
    MANE Plus Clinical transcript status
    canonical status of transcript
    APPRIS isoform annotation
    transcript support level
    biotype of transcript ("protein_coding" preferred)
    CCDS status of transcript
    consequence rank according to this table
    translated, transcript or feature length (longer preferred)
"Wherever possible we would discourage you from summarising data in this way. "
**** DONE Mail alexis
CLOSED: [2023-08-20 Sun 13:45] SCHEDULED: <2023-08-20 Sun>
**** TODO Données simuscop 200x
SCHEDULED: <2023-12-02 Sat>
**** DONE En T2T avec liftover (filtre = spip) : ok mais lent et trop de variants

[15.44924]

[12.67925]

0       0.0         18
   7 │ chr17     10296150  T        A        chr17:g.10296150T>A   60.0       0.0          3
   8 │ chr17     61968202  A        C        chr17:g.61968202A>C   60.0       0.0         46
   9 │ chr21     43426167  C        T        chr21:g.43426167C>T    0.0       0.0         88
  10 │ chrX     124056226  T        G        chrX:g.124056226T>G   60.0       0.0         40
  11 │ chrX      24737739  G        T        chrX:g.24737739G>T    60.0       0.0         16
  12 │ chrX      40591349  C        T        chrX:g.40591349C>T    60.0       0.0         37
  13 │ chrX      53193275  G        A        chrX:g.53193275G>A    60.0       0.0         32
 Le filtre est sur DP (read depth) et non la profondeur. Sur 1 et 3, DP=29 et 28...
 Si on est hétérozygote, le DP est la moitié de la profondeur donc c'est logique...
***** DONE Résultat après filter polymorphism : idem
CLOSED: [2023-08-16 Wed 20:18]
***** Résultat après filtre VEP
**** KILL [#B] Tout insérer dans NA12878 avec XAMscissors: reads manquants
CLOSED: [2023-08-19 Sat 20:04] SCHEDULED: <2023-08-14 Mon>
***** KILL Insertion
CLOSED: [2023-08-19 Sat 20:03]
On récupère le BAM
#+begin_src sh :dir /home/alex/code/bisonex/out
rsync -avz  meso:/Work/Users/apraga/bisonex/out/2300346867_NA12878-63118093_S260-GRCh38/preprocessing/mapped 2300346867_NA12878-63118093_S260-GRCh38/preprocessing/
#+end_src
#+begin_src sh :dir /home/alex/roam/research/bisonex/code/sanger
julia --project=.. xamscissors.jl
cd out-all
mv inserted_1.fq.gz NA12878-sanger-inserted-all_1.fq.gz
mv inserted_2.fq.gz NA12878-sanger-inserted-all_2.fq.gz
rsync -avz NA12878-sanger-inserted_* meso:/Work/Users/apraga/bisonex/data/
#+end_src
Fichier de configuration
patient,sample,fastq1,fastq2
NA12878,sanger-all,data/NA12878-sanger-inserted-all_1.fq.gz,data/NA12878-sanger-inserted-all_2.fq.gz
On lance la simulation
#+begin_src
nextflow run main.nf -profile standard,helios --input=samples-synthetic.csv --genome=GRCh38  -bg
#+end_src
***** DONE Résultat après haplotyecaller: 3 varinat perdus => ok
CLOSED: [2023-08-17 Thu 19:13]
Haplotypecaller 143 found over 146
3×3 DataFrame
| variant             | meanQual | depth |
|---------------------+----------+-------|
| chr12:g.13720138C>T |     60.0 |     1 |
| chr17:g.10296150T>A |     60.0 |     3 |
| chr21:g.43426167C>T |      0.0 |    88 |
Pas assez de read (1,2) et problème d'alignement (3)
***** KILL Résultat après filtre depth : +10 variants perduis
CLOSED: [2023-08-19 Sat 20:04] SCHEDULED: <2023-08-18 Fri>
filter depth : another 10 missed variants
10×3 DataFrame
| variant             | meanQual | depth |
|---------------------+----------+-------|
| chr3:g.71112628C>T  |     60.0 |    62 |
| chr12:g.40367710A>G |  58.0435 |    46 |
| chr14:g.58458545G>A |     60.0 |     9 |
| chr15:g.66703292C>T |     60.0 |    33 |
| chr16:g.30965737C>A |     60.0 |    18 |
| chr17:g.61968202A>C |     60.0 |    46 |
| chrX:g.124056226T>G |     60.0 |    40 |
| chrX:g.24737739G>T  |     60.0 |    16 |
| chrX:g.40591349C>T  |     60.0 |    37 |
| chrX:g.53193275G>A  |     60.0 |    32 |
|                     |          |       |
S'ils sont hétérozygotes, 0.5*depth est effectivement < 30 (notre filtre...)
****** KILL Problème d'inserstion des reads: on en perd de nombreux ! -> regénérer données
CLOSED: [2023-08-19 Sat 20:04] SCHEDULED: <2023-08-18 Fri>
Ex: chrX:g.124056226T>G : on passe de 65 reads à 1
***** DONE Résultat après filtre common variant: +0 ok
CLOSED: [2023-08-17 Thu 19:32]
***** KILL Résultat après filtre VEP : +23 perdus ??
CLOSED: [2023-08-19 Sat 20:04] SCHEDULED: <2023-08-18 Fri>
filter vep : another 23 missed variants
23×3 DataFrame
 Row │ variant               meanQual  depth
     │ String                Float64   Int64
─────┼───────────────────────────────────────
   1 │ chr1:g.183222115C>T    60.0       168
   2 │ chr1:g.39388062C>T     60.0       285
   3 │ chr2:g.240719197G>C    60.0        77
   4 │ chr3:g.41227353G>C     60.0       105
   5 │ chr4:g.15536991T>G     60.0        41
   6 │ chr5:g.14474096G>A     60.0       191
   7 │ chr8:g.43122149C>T     60.0       237
   8 │ chr9:g.128603589A>C    60.0       304
   9 │ chr9:g.137452819G>C    60.0       107
  10 │ chr10:g.129957338T>C   60.0       116
  11 │ chr10:g.247389T>G      60.0        56
  12 │ chr11:g.61313668G>A    60.0        83
  13 │ chr12:g.45850467C>T    60.0       291
  14 │ chr14:g.64216315C>G    60.0       263
  15 │ chr15:g.60514655G>A    60.0       259
  16 │ chr17:g.61966475G>T    60.0       144
  17 │ chr17:g.7852503T>C     60.0       190
  18 │ chr19:g.13230158G>A    60.0       172
  19 │ chr19:g.38523211C>G    60.0        93
  20 │ chr19:g.4110557G>C     59.9929    425
  21 │ chr20:g.62334188G>A    60.0        62
  22 │ chrX:g.47575255G>A     60.0       244
  23 │ chrX:g.53409112G>A     60.0       136
**** DONE [#A] Tout insérer dans NA12878 avec XAMscissors (XAMScissors à jour)
CLOSED: [2023-08-20 Sun 13:45] SCHEDULED: <2023-08-19 Sat>
***** DONE Insertion
CLOSED: [2023-08-20 Sun 09:15]
***** DONE Vérifier après haplotypecaller: 3 variants manquant mais ok
CLOSED: [2023-08-20 Sun 09:18] SCHEDULED: <2023-08-20 Sun>
3×3 DataFrame
 Row │ variant              meanQual  depth
     │ String               Float64   Int64
─────┼──────────────────────────────────────
   1 │ chr12:g.13720138C>T      60.0      1
   2 │ chr17:g.10296150T>A      60.0      1
   3 │ chr21:g.43426167C>T       0.0     59
Manque de profondeur sur 2 et mauvaise qualité sur 3
***** DONE Vérifier après filterdepth: 0 perdus en plus
CLOSED: [2023-08-20 Sun 09:18] SCHEDULED: <2023-08-20 Sun>
***** DONE Vérifier après filterpolymorphis : 0 perdus en plus
CLOSED: [2023-08-20 Sun 09:18] SCHEDULED: <2023-08-20 Sun>
***** DONE Vérifier après filter vep: 2 perdus en plus
CLOSED: [2023-08-20 Sun 12:37] SCHEDULED: <2023-08-20 Sun>
2×3 DataFrame
 Row │ variant             meanQual  depth
     │ String              Float64   Int64
─────┼─────────────────────────────────────
   1 │ chr17:g.7852503T>C      60.0     96
   2 │ chrX:g.47575255G>A      60.0    145
***** DONE 1ere correction spip: meilleur nombre de variants en sortie mais manque toujours ces 2
CLOSED: [2023-08-20 Sun 11:38]
***** DONE --pick : résout le problème
CLOSED: [2023-08-20 Sun 12:37]
chrX:g.47575255G>A est rendu downstream_gene_variant avec l'option --pick
Or il n'est pas en5' dans les transcrits refseq...
https://genome-euro.ucsc.edu/cgi-bin/hgTracks?db=hg38&lastVirtModeType=default&lastVirtModeExtraState=&virtModeType=default&virtMode=0&nonVirtPosition=&position=chrX%3A47575242%2D47575268&hgsid=301211823_xpelPqPJije7wSIhg070JeGH5ZwV
https://mobidetails.iurc.montp.inserm.fr/MD/api/variant/238296/browser/
Idem pour l'autre
   chr17:g.7852503T>C
https://mobidetails.iurc.montp.inserm.fr/MD/api/variant/182993/browser/
Note:
VEP chooses one block of annotation per variant, using an ordered set of criteria. This order may be customised using --pick_order.
    MANE Select transcript status
    MANE Plus Clinical transcript status
    canonical status of transcript
    APPRIS isoform annotation
    transcript support level
    biotype of transcript ("protein_coding" preferred)
    CCDS status of transcript
    consequence rank according to this table
    translated, transcript or feature length (longer preferred)
"Wherever possible we would discourage you from summarising data in this way. "
**** DONE Mail alexis
CLOSED: [2023-08-20 Sun 13:45] SCHEDULED: <2023-08-20 Sun>
**** TODO Données simuscop 200x
SCHEDULED: <2023-12-08 Fri>
**** DONE En T2T avec liftover (filtre = spip) : ok mais lent et trop de variants

Replacement in projects/bisonex.org at line 81 [9.35]

B:BD[12.76118] → [12.76118:76241]

B:BD[12.76241] → [4.41497:45881]

 where "Confirmed in sanger" == "true" | length
50
❯ open sangerized.csv | where "Found by bisonex" == "found" | wher
e "Confirmed in sanger" == "" | length
71
❯ open sangerized.csv | where "Found by bisonex" == "missed" | where "Confirmed in sanger" == "" | length
5
❯ open sangerized.csv | where "Found by bisonex" == "missed" | where "Confirmed in sanger" == "true" | length
0
[[id:cd79a77c-a0b6-4bb1-9e08-fe08dc89e3aa][Résultats finaux]]
*** DONE Regarder 5 variants manqués: 3 explicables, 2 non
CLOSED: [2023-11-09 Thu 00:22] SCHEDULED: <2023-11-05 Sun>
open searched.csv |  where "Found by bisonex" == "missed"
62982193  7884996 : haplotypecaller ok... -> filtré car AD=5 <= 10
63012582  102230760 : non présent haplotypcellar mais une délétion en 755 (en 754 CG -> C). Vérifié mobidetails
63019340  50721335 : non présent haplotypecaller (vérifié igv). vérifié mobidetails
63060439  26869324 : filtré car 15 reads
63109239  14358800 : présent haplotypecaller : filtré car DP=29 <= 30
Non présent haplotypecaller avec bcftools mais zgrep ok
zgrep 7884996 call_variant/haplotypecaller/*62982193*/*
zgrep 102230760 call_variant/haplotypecaller/*63012582*/*
zgrep 50721335 call_variant/haplotypecaller/*63019340*/*
zgrep 26869324 call_variant/haplotypecaller/*63060439*/*
zgrep 14358800 call_variant/haplotypecaller/*63109239*/*
*** DONE Flowchart
CLOSED: [2023-11-09 Thu 00:22]
*** DONE Refaire extraction
CLOSED: [2023-11-04 Sat 19:02] SCHEDULED: <2023-11-04 Sat>
*** DONE Refaire annotation avec mobidetails
CLOSED: [2023-11-04 Sat 19:02] SCHEDULED: <2023-11-04 Sat>
*** DONE Refaire annotation avec transcrit non reconnus
CLOSED: [2023-11-04 Sat 20:42] SCHEDULED: <2023-11-04 Sat>
5 transcrits, donnés égalemen tpar
#+begin_src nu
open annotated.csv | where coding != "negatif" | where chrom == ""
#+end_src
| 62676048 | NM_001080420.1 | SHANK3    | référénce non valide   |
| 62690893 | NM_001080420.1 | KDM6B     | idem                   |
| 62690893 | NM_001080420.1 | KDM6B     | même variant           |
| 62795429 | NM_016381.3    | TREX1 | NM_033629.5   |
| 63019340 | NM_001080420.1 | SHANK3 | NM_001372044.2 |
SCHEDULED: <2023-11-01 Wed>
*** DONE Rajouter variant pour 63009152
CLOSED: [2023-11-04 Sat 20:47] SCHEDULED: <2023-11-01 Wed>
*** DONE Regénérer annotation avec NC_
CLOSED: [2023-11-04 Sat 18:59] SCHEDULED: <2023-10-31 Tue>
*** DONE Comparer variants manqué avec sanger: 0 confirmés
CLOSED: [2023-11-06 Mon 23:48] SCHEDULED: <2023-11-04 Sat>
*** DONE Annoter variants avec sanger
CLOSED: [2023-11-08 Wed 23:17] SCHEDULED: <2023-11-07 Tue>
*** DONE Mail paul avec résultats
CLOSED: [2023-11-09 Thu 00:22] SCHEDULED: <2023-11-05 Sun>
*** DONE Vérifier coordonnées des 2 variants manquants
CLOSED: [2023-11-12 Sun 16:53] SCHEDULED: <2023-11-11 Sat>
Les 2 sont des homopolymer
- 1er = même variant mais représenté différement
- SHANK3 ?
**** PITX3: filtrée car AD=8
NB: représentation synonyme
Même séquence
  >hg38_dna range=chr10:102230742-102230777 5'pad=2 3'pad=2 strand=+ repeatMasking=none
GGAGCCAGCCCGGGGGGGCCCCCGCCCAGGCCCTG
>hg19_dna range=chr10:103990500-103990534 5'pad=0 3'pad=0 strand=+ repeatMasking=none
GGAGCCAGCCCGGGGGGGCCCCCGCCCAGGCCCTG
Selon IGV:
GGAGCCAGCCC(G)GGGGGGCCCCCGCCCAGGCCCTG
Selon cento
GGAGCCAGCCCGGGGGG(G)CCCCCGCCCAGGCCCTG
#+begin_src sh :dir ~/annex/data/bisonex/
bcftools filter -i 'POS=102230760' call_variant/haplotypecaller/*63012582*/*.vcf.gz
#+end_src
DP ok mais AD trop faible
 GT:AD:DP:GQ:PL  0/1:26,8:34:99:146,0,671
**** SHANK3: transcrit supprimé depuis: ok
Retrouvé par ERic: 50721504dup
On vérifie
#+begin_src sh :dir ~/annex/data/bisonex/
bcftools filter -i 'POS=50721504' call_variant/haplotypecaller/*63019340*/*.vcf.gz
#+end_src
#+begin_src sh :dir ~/annex/data/bisonex/
zgrep '50721504' annotate/full/*63019340*.tsv
#+end_src
*** TODO Sanger pour 4 VOUS manqués
SCHEDULED: <2023-12-13 Wed>
/Entered on/ [2023-11-13 Mon 22:40]
** TODO Chercher nouveaux gènes
SCHEDULED: <2023-12-06 Wed>
* Résultats
** TODO Speed-up BWA-mem
SCHEDULED: <2023-12-02 Sat>
** TODO Speed-up Hapotypecaller
SCHEDULED: <2023-12-02 Sat>
** TODO Refaire statistics avec happy+ vcfeval
SCHEDULED: <2023-12-04 Mon>
/Entered on/ [2023-11-18 Sat 20:13]
* Communication
** DONE Mail NGS-diag
CLOSED: [2023-10-06 Fri 08:04] SCHEDULED: <2023-10-06 Fri>
/Entered on/ [2023-10-04 Wed 19:33]

[12.76118]

 where "Confirmed in sanger" == "true" | length
50
❯ open sangerized.csv | where "Found by bisonex" == "found" | where "Confirmed in sanger" == "" | length
71
❯ open sangerized.csv | where "Found by bisonex" == "missed" | where "Confirmed in sanger" == "" | length
5
❯ open sangerized.csv | where "Found by bisonex" == "missed" | where "Confirmed in sanger" == "true" | length
0
[[id:cd79a77c-a0b6-4bb1-9e08-fe08dc89e3aa][Résultats finaux]]
*** DONE Regarder 5 variants manqués: 3 explicables, 2 non
CLOSED: [2023-11-09 Thu 00:22] SCHEDULED: <2023-11-05 Sun>
open searched.csv |  where "Found by bisonex" == "missed"
62982193  7884996 : haplotypecaller ok... -> filtré car AD=5 <= 10
63012582  102230760 : non présent haplotypcellar mais une délétion en 755 (en 754 CG -> C). Vérifié mobidetails
63019340  50721335 : non présent haplotypecaller (vérifié igv). vérifié mobidetails
63060439  26869324 : filtré car 15 reads
63109239  14358800 : présent haplotypecaller : filtré car DP=29 <= 30
Non présent haplotypecaller avec bcftools mais zgrep ok
zgrep 7884996 call_variant/haplotypecaller/*62982193*/*
zgrep 102230760 call_variant/haplotypecaller/*63012582*/*
zgrep 50721335 call_variant/haplotypecaller/*63019340*/*
zgrep 26869324 call_variant/haplotypecaller/*63060439*/*
zgrep 14358800 call_variant/haplotypecaller/*63109239*/*
*** DONE Flowchart
CLOSED: [2023-11-09 Thu 00:22]
*** DONE Refaire extraction
CLOSED: [2023-11-04 Sat 19:02] SCHEDULED: <2023-11-04 Sat>
*** DONE Refaire annotation avec mobidetails
CLOSED: [2023-11-04 Sat 19:02] SCHEDULED: <2023-11-04 Sat>
*** DONE Refaire annotation avec transcrit non reconnus
CLOSED: [2023-11-04 Sat 20:42] SCHEDULED: <2023-11-04 Sat>
5 transcrits, donnés égalemen tpar
#+begin_src nu
open annotated.csv | where coding != "negatif" | where chrom == ""
#+end_src
| 62676048 | NM_001080420.1 | SHANK3    | référénce non valide   |
| 62690893 | NM_001080420.1 | KDM6B     | idem                   |
| 62690893 | NM_001080420.1 | KDM6B     | même variant           |
| 62795429 | NM_016381.3    | TREX1 | NM_033629.5   |
| 63019340 | NM_001080420.1 | SHANK3 | NM_001372044.2 |
SCHEDULED: <2023-11-01 Wed>
*** DONE Rajouter variant pour 63009152
CLOSED: [2023-11-04 Sat 20:47] SCHEDULED: <2023-11-01 Wed>
*** DONE Regénérer annotation avec NC_
CLOSED: [2023-11-04 Sat 18:59] SCHEDULED: <2023-10-31 Tue>
*** DONE Comparer variants manqué avec sanger: 0 confirmés
CLOSED: [2023-11-06 Mon 23:48] SCHEDULED: <2023-11-04 Sat>
*** DONE Annoter variants avec sanger
CLOSED: [2023-11-08 Wed 23:17] SCHEDULED: <2023-11-07 Tue>
*** DONE Mail paul avec résultats
CLOSED: [2023-11-09 Thu 00:22] SCHEDULED: <2023-11-05 Sun>
*** DONE Vérifier coordonnées des 2 variants manquants
CLOSED: [2023-11-12 Sun 16:53] SCHEDULED: <2023-11-11 Sat>
Les 2 sont des homopolymer
- 1er = même variant mais représenté différement
- SHANK3 ?
**** PITX3: filtrée car AD=8
NB: représentation synonyme
Même séquence
  >hg38_dna range=chr10:102230742-102230777 5'pad=2 3'pad=2 strand=+ repeatMasking=none
GGAGCCAGCCCGGGGGGGCCCCCGCCCAGGCCCTG
>hg19_dna range=chr10:103990500-103990534 5'pad=0 3'pad=0 strand=+ repeatMasking=none
GGAGCCAGCCCGGGGGGGCCCCCGCCCAGGCCCTG
Selon IGV:
GGAGCCAGCCC(G)GGGGGGCCCCCGCCCAGGCCCTG
Selon cento
GGAGCCAGCCCGGGGGG(G)CCCCCGCCCAGGCCCTG
#+begin_src sh :dir ~/annex/data/bisonex/
bcftools filter -i 'POS=102230760' call_variant/haplotypecaller/*63012582*/*.vcf.gz
#+end_src
DP ok mais AD trop faible
 GT:AD:DP:GQ:PL  0/1:26,8:34:99:146,0,671
**** SHANK3: transcrit supprimé depuis: ok
Retrouvé par ERic: 50721504dup
On vérifie
#+begin_src sh :dir ~/annex/data/bisonex/
bcftools filter -i 'POS=50721504' call_variant/haplotypecaller/*63019340*/*.vcf.gz
#+end_src
#+begin_src sh :dir ~/annex/data/bisonex/
zgrep '50721504' annotate/full/*63019340*.tsv
#+end_src
*** TODO Sanger pour 4 VOUS manqués
SCHEDULED: <2023-12-13 Wed>
/Entered on/ [2023-11-13 Mon 22:40]
** TODO Chercher nouveaux gènes
SCHEDULED: <2023-12-06 Wed>
* Résultats
** TODO Speed-up BWA-mem
SCHEDULED: <2023-12-08 Fri>
** TODO Speed-up Hapotypecaller
SCHEDULED: <2023-12-08 Fri>
** TODO Refaire statistics avec happy+ vcfeval
SCHEDULED: <2023-12-04 Mon>
/Entered on/ [2023-11-18 Sat 20:13]
* Communication
** DONE Mail NGS-diag
CLOSED: [2023-10-06 Fri 08:04] SCHEDULED: <2023-10-06 Fri>
/Entered on/ [2023-10-04 Wed 19:33]
* Presentations
** TODO Abstract FOSDEM 2024
DEADLINE: <2023-12-07 Thu> SCHEDULED: <2023-12-04 Mon>
/Entered on/ [2023-12-03 Sun 23:17]
https://pretalx.fosdem.org/fosdem-2024/submit/SLegDF/questions/

Insertion in notes/reviews/jakobs2023.org at line 1 [7.9011]
[7.9011]
[17.8522]
```
#+options: author:nil
```

Replacement in notes/reviews/jakobs2023.org at line 17 [7.9011]

B:BD[17.8568] → [17.8568:8724]

- SIMT : mettre acronymoe (single execution, multiple threads)
- Dire que WSM7 est un modèle de microphysique seule ? La phre suivante prête à confusion

[17.8568]

[17.8724]

- [X] SIMT : mettre acronymoe (single execution, multiple threads)
- [X] Dire que WSM7 est un modèle de microphysique seule ? La phre suivante prête à confusion

Replacement in notes/reviews/jakobs2023.org at line 22 [7.9011]

∅:D[17.8835] → [7.9832:9870]

B:BD[7.9832] → [7.9832:9870]

B:BD[7.9870] → [17.8836:8936]

- Grille : régulière ? À préciser
- Préciser étendue du modèle (national probablement)
- typo: ": A higher"
- fusionner ces phrase

[17.8835]

[17.8936]

- [X] Grille : régulière ? À préciser
- [X] Préciser étendue du modèle (national probablement)
- [X] typo: ": A higher"
- [X] fusionner ces phrase

Replacement in notes/reviews/jakobs2023.org at line 32 [7.9011]
B:BD[17.9239] → [17.9239:9251]
```
- fusionner
```
[17.9239]
[7.9988]
```
- [X] fusionner
```

Replacement in notes/reviews/jakobs2023.org at line 42 [7.9011]

B:BD[17.9608] → [17.9608:9763]

- La partie "In detail, this article provides the following contributions:" peut être fusionnée avec la structure de l'article.
- Changer tasks -> model

[17.9608]

[7.10402]

- [X] La partie "In detail, this article provides the following contributions:" peut être fusionnée avec la structure de l'article.
- [X] Changer tasks -> model

Replacement in notes/reviews/jakobs2023.org at line 52 [7.9011]

B:BD[17.10020] → [17.10020:10148]

Speed-up: préciser que c'est pour le GPU et qu'il  fsemble être plus intéressant de la bibliography (ou dans l'introduction)

[17.10020]

[17.10148]

- [X] Speed-up: préciser que c'est pour le GPU et qu'il  fsemble être plus intéressant de la bibliography (ou dans l'introduction)

Replacement in notes/reviews/jakobs2023.org at line 54 [7.9011]

B:BD[17.10153] → [17.10153:10337]

- Les 2 phrases peuvent être résumée en : "a custom dynamic load balancing method for heterogenous architecture is presented to achieve the lowest execution tme for each time step"

[17.10153]

[17.10337]

- [X] Les 2 phrases peuvent être résumée en : "a custom dynamic load balancing method for heterogenous architecture is presented to achieve the lowest execution tme for each time step"

Replacement in notes/reviews/jakobs2023.org at line 62 [7.9011]

B:BD[17.10657] → [17.10657:10778]

- C++ ? Remplacer les mentions de C dans le reste de l'article alors
- Préciser la phrase suivante ("insufficiently" ?)

[17.10657]

[17.10778]

- [X] C++ ? Remplacer les mentions de C dans le reste de l'article alors
- [X] Préciser la phrase suivante ("insufficiently" ?)

Replacement in notes/reviews/jakobs2023.org at line 68 [7.9011]

B:BD[17.10976] → [17.10976:11094]

- Ce qui manque est la définition d'une tache au sens GPU (et CPU) : a priori, correspond à un ensemble de colonnes

[17.10976]

[17.11094]

- [X] Ce qui manque est la définition d'une tache au sens GPU (et CPU) : a priori, correspond à un ensemble de colonnes

Replacement in notes/reviews/jakobs2023.org at line 70 [7.9011]

B:BD[17.11102] → [17.11102:11186]

B:BD[17.11186] → [4.45944:46023]

∅:D[4.46023] → [17.11262:11321]

B:BD[17.11262] → [17.11262:11321]

- Fig 2 : représentation de la donnée en mémoire ? à préciser dans la légende
- À part les données 4D, y a-t-il eu d'autres restructuration des données ?
- Figure 2 : type "Daten" -> data, type "direkt" -> direct

[17.11102]

[4.46024]

- [X] Fig 2 : représentation de la donnée en mémoire ? à préciser dans la légende
# - À part les données 4D, y a-t-il eu d'autres restructuration des données ?
- [X] Figure 2 : type "Daten" -> data, type "direkt" -> direct

Replacement in notes/reviews/jakobs2023.org at line 74 [7.9011]
B:BD[4.46037] → [4.46037:46072]
```
Erreur dans le calcul du speedup ?
```
[4.46037]
[4.46072]
```
- [X] Erreur dans le calcul du speedup ?
```

Replacement in notes/reviews/jakobs2023.org at line 85 [7.9011]

∅:D[18.336] → [4.46221:46302]

B:BD[17.11326] → [4.46221:46302]

- WPS = WRF -preprocessing system : mettre acronyme
- CONUS = mettre acronymerx?

[18.336]

[7.10874]

- [X] WPS = WRF -preprocessing system : mettre acronyme
- [X] CONUS = mettre acronymerx?

Replacement in notes/reviews/jakobs2023.org at line 88 [7.9011]

B:BD[7.10880] → [18.337:487]

- Comment est défine "overall precipitation" ? Les auteurs semblent se baser dessus pour étudier l'absence d'impact sur l'overall donc à préciser

[7.10880]

[18.487]

- [X] Comment est défine "overall precipitation" ? Les auteurs semblent se baser dessus pour étudier l'absence d'impact sur l'overall donc à préciser

Replacement in notes/reviews/jakobs2023.org at line 92 [7.9011]

B:BD[18.717] → [18.717:866]

- comment l'utilisation de fonction en double récision a-t-elle modifiée les résultats (donner des valeurs et pas juste "still minor deviations")

[18.717]

[18.866]

- [X] comment l'utilisation de fonction en double récision a-t-elle modifiée les résultats (donner des valeurs et pas juste "still minor deviations")

Replacement in notes/reviews/jakobs2023.org at line 94 [7.9011]

B:BD[18.887] → [18.887:1222]

- eComparaison entre Fortran et GPU: ok pour la non-régression mais lequel est le plus précis par rapport aux observations ? On s'attend à ce que la version parallèle soit "moins bonnes" mais elle prédit un peu plus de heavy rainfall (plus précis car double précision ?)
- testé sur le modèle simple en 2D de Bae et al 2018 ?

[18.887]

[17.11327]

- [X] Comparaison entre Fortran et GPU: ok pour la non-régression mais lequel est le plus précis par rapport aux observations ? On s'attend à ce que la version parallèle soit "moins bonnes" mais elle prédit un peu plus de heavy rainfall (plus précis car double précision ?)
- [X] testé sur le modèle simple en 2D de Bae et al 2018 ?

Replacement in notes/reviews/jakobs2023.org at line 98 [7.9011]

B:BD[18.1231] → [3.89:282]

∅:D[3.282] → [18.1231:1304]

B:BD[18.1231] → [18.1231:1304]

∅:D[18.1304] → [19.9610:9702]

B:BD[19.9610] → [19.9610:9702]

- Methodologie : comment est mesuré le temps d'exécution pour GPU ?
- Important: fig7 speedup calculé par pas de temps ??? (notion de moyenne) -> qu'en est-il du temps total d'exécution ??
- Pourquoi gain est speedup est faible en doublant le nombre de points ?
- 5.3: comment est calculé le maximum speedup (mesure/calcul ? détailler dans les 2 cas)?

[18.1231]

[18.1305]

- [X] Methodologie : comment est mesuré le temps d'exécution pour GPU ?
- [X] Important: fig7 speedup calculé par pas de temps ??? (notion de moyenne) -> qu'en est-il du temps total d'exécution ??
- [X] Pourquoi gain est speedup est faible en doublant le nombre de points ?
- [X] 5.3: comment est calculé le maximum speedup (mesure/calcul ? détailler dans les 2 cas)?

Replacement in notes/reviews/jakobs2023.org at line 109 [7.9011]

B:BD[3.318] → [3.318:765]

∅:D[3.765] → [19.9798:9983]

B:BD[19.9798] → [19.9798:9983]

- Problème : la version Fortran originale n'est pas parallisée mais est maintenant multi-threadée. Préciser dans 5.2 si c'est la version séquentielle utilisée et préciser ici que c'est une version parallilées (et comment ?)
- L'étape sur GPU a-t-elle été désactivée pour cette comparaison sur le temps de calcul ?
- Dans la discussion, préciser de quelle version en Fortran (séquentielle ou parallèle) notamment dans la conclusion
- 5.3 : manque majuscule à "thus"
- Pas clair : tâche dans quel sens ? Au lieu d'avoir une grosse boucle, on a des appels de fonctions dedans ? Ou bien sur des threads différentes ?

[3.318]

[19.9983]

- [X] Problème : la version Fortran originale n'est pas parallisée mais est maintenant multi-threadée. Préciser dans 5.2 si c'est la version séquentielle utilisée et préciser ici que c'est une version parallilées (et comment ?)
- [X] L'étape sur GPU a-t-elle été désactivée pour cette comparaison sur le temps de calcul ?
- [X] Dans la discussion, préciser de quelle version en Fortran (séquentielle ou parallèle) notamment dans la conclusion
- [X] 5.3 : manque majuscule à "thus"
- [X] Pas clair : tâche dans quel sens ? Au lieu d'avoir une grosse boucle, on a des appels de fonctions dedans ? Ou bien sur des threads différentes ?

Replacement in notes/reviews/jakobs2023.org at line 117 [7.9011]

B:BD[19.10194] → [19.10194:10316]


5.4: maintenant la version "hôte"  est en Fortran et non en C ??? À préciser (semble être le cas avec la conclusion)

[19.10120]

[19.10316]

- [X] On regrettera l'absence de détail sur l'implémentation du multi-threading
**** 5.4
maintenant la version "hôte"  est en Fortran et non en C ??? À préciser (semble être le cas avec la conclusion)

Replacement in notes/reviews/jakobs2023.org at line 125 [7.9011]

B:BD[19.10504] → [19.10504:10812]

B:BD[19.10812] → [17.11344:11429]

- De manière générale, chiffres sur un seul run ? À préciser
- figure 11: low-pass filter = filtre sur variant de forte amplitude
- les auteurs ont-il essayé de faire une moyenne "glissante" en modifiant la charge de calcul par rapport à un temps moyens, par exemple sur 100 itérations pour lisser ?
NB: regarder rapidement s'il y a des stratégies connnues de load balancing pour GPU

[19.10504]

[17.11429]

- [X] De manière générale, chiffres sur un seul run ? À préciser
# - figure 11: low-pass filter = filtre sur variant de forte amplitude
# NB: regarder rapidement s'il y a des stratégies connnues de load balancing pour GPU

Replacement in notes/reviews/jakobs2023.org at line 129 [7.9011]

∅:D[17.11443] → [19.10825:10901]

B:BD[19.10825] → [19.10825:10901]

B:BD[19.10901] → [17.11444:11750]

- futur ? sur quelle architecture envisagent-ils de tourner en production ?
- test autre algorithm de load balacing ? ex: J. Fang, J. Zhang, S. Lu and H. Zhao, "Exploration on Task Scheduling Strategy for CPU-GPU Heterogeneous Computing System," 2020 IEEE Computer Society Annual Symposium on VLSI (ISVLSI), Limassol, Cyprus, 2020, pp. 306-311, doi: 10.1109/ISVLSI49217.2020.00063.

[17.11443]

[17.11750]

- ouverture :
  - sur quelle architecture envisagent-ils de tourner en production ?
  - les auteurs ont-il essayé de faire une moyenne "glissante" en modifiant la charge de calcul par rapport à un temps moyens, par exemple sur 100 itérations pour lisser ?
  - test autre algorithm de load balacing ? ex: J. Fang, J. Zhang, S. Lu and H. Zhao, "Exploration on Task Scheduling Strategy for CPU-GPU Heterogeneous Computing System," 2020 IEEE Computer Society Annual Symposium on VLSI (ISVLSI), Limassol, Cyprus, 2020, pp. 306-311, doi: 10.1109/ISVLSI49217.2020.00063.

Replacement in notes/reviews/jakobs2023.org at line 134 [7.9011]
B:BD[17.11819] → [17.11819:11829]
```
* Rapport
```
[17.11819]
[17.11829]
```
* Review
```

Replacement in notes/reviews/jakobs2023.org at line 137 [7.9011]

B:BD[17.11925] → [17.11925:11936]

** alidity

[17.11925]

[17.11936]

The authors present the results of porting of the latest microphysics model from the WRF framework to an heterogenous architecture CPU/GPU using Fortran and CUDA. Load balancing is done with a custom strategy. Accuracy and performance are highlighted.
** Validity

Insertion in notes/reviews/jakobs2023.org at line 140 [7.9011]

[17.12039]

No major flaws were found. However, the paper would profit from clarifying several points (see Data & metholodology).

Insertion in notes/reviews/jakobs2023.org at line 142 [7.9011]

[17.12071]

The author gives an honest feedback for the difficult task of porting a code to a new architecture.
Their results are of interest for the atmospheric community as it provides valuable input for the role of GPU hardware in newer codes.

Replacement in notes/reviews/jakobs2023.org at line 145 [7.9011]

B:BD[17.12146] → [17.12146:12167]

** ata & methodology

[17.12146]

[17.12167]

** Data & methodology
Regarding reproductibility, is the code for WSM7 available online ? Without it, results cannot be reproduced. Otherwise, compiler and architectures are properly specified. Several points below could be cleared up precised for methodology.
*** Section 3
In Section 3.2 : a "task" is never defined properly in the text. Is it a set of columns allocated to a thread ?
Implementing multi-threading on the CPU is not explained. Balancing the workload (i.e vertical columns) is not a trivial problem so more details would be helpful.
- Section 3.3 : for speedup < 1, Eq. (2) yield $p_{dev} < 1$. Shouldn't Eq. (2) be instead
$$p_{dev} = \frac{S_{dev}}{S_{dev} + 1} $$
?
The following sentence could be more explicit: how is it "insufficient" ?
#+begin_quote
due to the extensive usage of object orientation for the creation of GPU tasks, which only
can be represented insufficiently in Fortran based approaches like CUDA-Fortran.
#+end_quote
*** Section 4
In Section 4.2, How did the switch to double precision affect precision (Fig. 4 and 5) ? Also, how is defined overall precipitation, in contrast to time step wise precipitation ?
In Section 4.3, the authors rightly did a non-regression test for the GPU version. However, it was not compared to real-world observation in the accuraccy assessment. Did the GPU version result in a more accurate result due to double precision ?
Also, was the parallel model testing on a simple analytical test case (like the 2D model of Bae et al, 2018) ?
*** Section 5
In Section 5.2, how is measured the GPU execution time ? In Fig. 7, is the speedup computed per time-step ? If that is the case, are results similar for total running time on the GPU ?
In Section 5.3, is the maximum speedup computed or measured ?
It seems there are 2 fortran versions of the code : one sequential ("original implementation") and a multi-threaded one. In section 5.3 and elsewhere, it should be clearer which version it is.
For the running times presented here, was computation on the GPU disabled ?
The authors claim that
#+begin_quote
In the C implementation, single calculation steps are described isolated from each other in separate tasks. thus, the compiler is not able to perform optimization across multiple steps but only within a single task".
#+end_quote
This point needs to be clarified: is it simply a different code structure (using functions instead of a loop) or a different algorithm ?

Insertion in notes/reviews/jakobs2023.org at line 182 [7.9011]
[17.12564]
[17.12564]
```
Yes
```
Insertion in notes/reviews/jakobs2023.org at line 186 [7.9011]
[17.13000]
[17.13000]
```
Conclusions are valid and reliable.
```
Insertion in notes/reviews/jakobs2023.org at line 188 [7.9011]
[17.13026]
[17.13026]
```
No inappropriate language.
```

Insertion in notes/reviews/jakobs2023.org at line 191 [7.9011]

[17.13143]

The main points have been listed in Data & methodology. Here are additional suggestions.
In the introduction, it should be said that WSM7 is a microphysics model as this sentence may not be clear enough
#+begin_quote
The most recent model of this category is the WRF Single-Moment 7-class (WSM7) model
#+end_quote
If the model uses a regular latitude-longitude grid, it could be added there. Also the scope of the model (national/european) could be added too.
In Section 5.2 : the following sentencs needs to be clearer about the notion of "better overlapping"
#+begin_quote
A higher number of CPU threads introduces a better overlapping of memory and computation tasks for the GPU but is not able to further reduce the runtime.
#+end_quote
In section 2 or in the introduction, it could be stressed the current literature is in favor of GPU regarding speedup for this model.
In the conclusion, if the authors want to open up the discussion, it would be interesting to discuss the future of this code, especially the architecture used in production. Load balancing is also a difficult issue and other strategies could be tested in later papers. For example by averaging load over several time steps or with strageties from the literature, like Fang et al 2020 [fn:1]. Studying load repartion on the grid and its evolution would also be informative.
*** Writing suggestions
Below are some recommandation regarding the writing.
In the introduction, the following two sentences could be merged for clarity
#+begin_quote
Additionally, the capabilities of GPUs can be utilized which allows
for a hybrid CPU/GPU implementation of the WSM7 simulations. This requires an
analysis of data structures and data transfers which introduces the additional pos-
sibility of a hybrid execution on CPU and GPU.
#+end_quote
and
#+begin_quote
 the simulation is split into separate tasks for
which the placement on CPU or GPU can be determined individually in each simula-
tion time step. This allows for a dynamic load balancing mechanism to be introduced
#+end_quote
For example:
#+begin_quote
 In the C implementation, single calculation steps are described
isolated from each other in separate tasks. thus, the compiler is not able to perform
optimization across multiple steps but only within a single task
#+end_quote
In the introduction, please change task to model in
#+begin_quote
- a C/CPU parallelization for the WSM7 tasks
- a CUDA/GPU parallelization for the WSM7 tasks
#+end_quote
Also, the paragraph beginning with "In detail, this article provides the following contributions:" could be merged with the presentation of the outline.
In section 3, the following sentence
#+begin_quote
 Finally, a dynamic task distribution method is presented, which
focuses on reaching the lowest possible execution time in every time step. In order to
achieve this, the workload has to be distributed among the heterogeneous system such
that the execution time of the components match.
#+end_quote
could be simplified to
#+begin_quote
a custom dynamic load balancing method for heterogenous architecture is presented to achieve the lowest execution tme for each time step
#+end_quote
In section 3.1, please replace C++ by C if that's correct.
Acronyms are not defined for
- SIMT (single execution, multiple threads) in the introduction,
- WPS = WRF -preprocessing system  in 4.2
- CONUS in 4.2
Typographical erors
- introduction ": a higher" should be lower case
- Section 4.2, figure 2 : replace "Daten" by data and "direkt" by direct
- Section 5.3 : "thus" should be upper case

Insertion in notes/reviews/jakobs2023.org at line 263 [7.9011]

[17.13235]

Literature is referenced accordingly. If the authors have some references for load balancing strategies, it could be added.

Insertion in notes/reviews/jakobs2023.org at line 266 [7.9011]
[17.13472]
[17.13472]
```
Astract, introduction and conclusion are appropriate.
```

Replacement in notes/reviews/jakobs2023.org at line 268 [7.9011]

B:BD[17.13565] → [17.13565:13911]

** Please indicate any particular part of the manuscript, data, or analyses that you feel is outside the scope of your expertise, or that you were unable to assess fully.
** Please address any other specific questions asked by the editor.
** Please make sure to check if author(s) have followed our Sex and Gender in Research (SAGER Guidelines).

[17.13565]

# ** Please indicate any particular part of the manuscript, data, or analyses that you feel is outside the scope of your expertise, or that you were unable to assess fully.
* Footnotes
[fn:1]
  J. Fang, J. Zhang, S. Lu and H. Zhao, "Exploration on Task Scheduling Strategy for CPU-GPU Heterogeneous Computing System," 2020 IEEE Computer Society Annual Symposium on VLSI (ISVLSI), Limassol, Cyprus, 2020, pp. 306-311, doi: 10.1109/ISVLSI49217.2020.00063.

File addition: python.org (----------)

[20.29]

* Charger un script
#+begin_src python
exec(open("test.py").read())
#+end_src

Insertion in notes/nushell.org at line 4 [21.60]

[21.82]

[22.16768]

* Intégration
** TODO Doom-emacs
** Python avec virtual env
Installer virtualenv, exemple avec `emerge virtualenv` puis
#+begin_src
virtualenv myenv
overlay use myenv/bin/activate.nu
pip install osmnx
#+end_src