apraga/org - Change XBXXQ7NGCA2AM7F6DODF75VNIA52J3MNYSLNAYRRC2KKYJUVCN2QC

Wrong patient in xamscissors. Workout

Created by Alexis Praga on August 16, 2023

XBXXQ7NGCA2AM7F6DODF75VNIA52J3MNYSLNAYRRC2KKYJUVCN2QC

Dependencies

In channels

main

Change contents

Insertion in workout.org at line 6599 [5.1]

[4.54]

* <2023-08-15 Tue> Workout
 Circuit 3x{1+1}
 Position : 2s (sauf RTO = 5), répétitions x1
* <2023-08-16 Wed> Tricking
25 front kick
15 crescend (font + back)
26 hook kick,
5+5 tornado kick progression
10 cartwheel

Replacement in projects/bisonex.org at line 3 [7.35]

B:BD[6.16390] → [3.29:8221]

l#downloadAlt
- alt = séquences alternatives (utilisables)
- fix = patch (correction ou amélioration)
- random = séquence connue sur un chromosome mais non encore utilisée
** Pipelines prêt-à-l’emploi nextflow
Problème : nécessite singularity ou docker (ou conda)
Potentiellement utilisable avec nix...
** Validation : Quelles données de référence ?
Discussion avec Alexis
- Platinum genomes = génome seul
*** [[https://github.com/genome-in-a-bottle/giab_data_indexes][Genome in a bottle]]
  - NA12878 :
    - Illumina HiSeq Exome : fastq + capture en hg37
    - Illumina TruSeq Exome : bam, pas de capture
    - Exomes en hg37 https://zenodo.org/record/3597727 avec capture
      - HiSeq2000
      - NextSeq 500
      - HiSeq 2500
  - HG002,3,4
    - Illumina Whole Exome  : bam. le kit de capture est "Agilent SureSelect Human All Exon V5 kit" selon [[https://ftp-trace.ncbi.nlm.nih.gov/giab/ftp/data/AshkenazimTrio/analysis/OsloUniversityHospital_Exome_GATK_jointVC_11242015/README.txt][README]]. On il faut les régions [[https://kb.10xgenomics.com/hc/en-us/articles/115004150923-Where-can-I-find-the-Agilent-Target-BED-files-][selon ce site]]
      Un autre fichier est disponible (capture ???)
    https://ftp-trace.ncbi.nlm.nih.gov/giab/ftp/data/AshkenazimTrio/analysis/OsloUniversityHospital_Exome_GATK_jointVC_11242015/wex_Agilent_SureSelect_v05_b37.baits.slop50.merged.list
  "target region" +/- 50bp
    testé sur chr311780-312086 : ok
Autres technologies non adaptées au pipeline (vu avec Alexis)
*** [[https://www.illumina.com/platinumgenomes.html][Platinum genome
]] Que du génome « sequenced to 50x depth on a HiSeq 2000 system”
Genome possible
*** 1000 genomes
- intersection des capture + CCDS  [[id:b77e64fa-06a8-4ffa-8b5b-ab3fda684b61][Données brutes exome 1000 Genomes (fastq + capture)]]
- Broad instute : SureSelect human all exon v2 target capture kit : non disponible sur le site d'agilent (V6 ou plus)
*** Zone de capture
GIAB fourni le .bed pour l'exome . INfo : https://support.illumina.com/sequencing/sequencing_kits/nextera-rapid-capture-exome-kit/downloads.html
*** Valider la méthode
- 1000 genomes + SureSelect human all exon v2 target capture kit : non disponible sur le site d'agilent (V6 ou plus)
  https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-019-2928-9
- GIAB + liftover du fichire de capture en hg38
Ce qui est aussi fait par
https://bcbio-nextgen.readthedocs.io/en/stable/contents/germline_variants.html
Mais avec UCSC liftover
** Centogène
https://www.twistbioscience.com/node/23906
Bed non fourni pour exactement cette capture
On prend https://www.twistbioscience.com/resources/data-files/twist-alliance-vcgs-exome-401mb-bed-files
qui content la majeure partie
* Réunion
** <2023-08-10 Thu> Alexis
Ok pour bloquer le développment d'ici mardi prochain
Dév:
- pipeline jusque VEP en T2T + GRCh38
- ok pour valider spip T2T sur quelques variant => à intégrer au pipeline
- annotation :
  - ok pour mobidetails hg38
  - +OMIM T2T+ non
  - +franklin hg38+ non pour le moment
- métriques (fastq a minima) + rapport multiqc
- optionnel
  - reformater la sortie
- on abandonne
  - XAMScissors ave indel
  - parallélisation haplotype caller
  - spliceai à la vollée
  - pangolin
Test
- GIAB:
  - hg38: ok pour refaire les tests NA12878 avec données cento, sinon ok pour "c'est difficile" sur les 3 fichiers de capture
  - T2T: ok pour faire des tests rapides mais probablement pas assez de temps !
- patient de synthèse : variant cento confirém par sanger seuls
Résultats
- ok pour scale up bwa mem et haplotyecaller
Manuscrit
- validation de méthode : laisser tomber la version actuelle et faire comme strasbourg (cf ngs diag) dans la présentatino
- a envoyé le powerponit avec les références des différsences articles
- ok pour robo4 si résultat
- architecture cible = VM : 78 coeurs 54Go RAUM et 1To espace disque
Passage en production : ok pour présentation rapide du code
* Nixpkgs :nix:
** DONE GATK
CLOSED: [2023-05-06 Sat 08:51]
*** DONE [[https://github.com/NixOS/nixpkgs/pull/185819][Binaire]]
CLOSED: [2022-09-10 Sat 23:53] SCHEDULED: <2022-08-10 Wed>
/Entered on/ [2022-08-09 Tue 10:57]
PR submitted
*** KILL Corriger code pour utiliser source
CLOSED: [2022-09-11 Sun 22:05]
*** DONE Corriger PATH pour include java et python
CLOSED: [2022-10-11 Tue 11:46]
https://github.com/NixOS/nixpkgs/pull/191548
Review <2022-10-10 Mon> , corrigé dans la journée
*** DONE Update 4.3.0.0
CLOSED: [2023-04-13 Thu 09:01]
** HOLD Nextflow
*** KILL version script seule
CLOSED: [2023-04-01 Sat 18:29]
Fix pour SGE et nextflow
https://github.com/NixOS/nixpkgs/issues/192396
*** KILL Version avec gradle
CLOSED: [2022-10-09 Sun 22:51]
*** HOLD [[https://github.com/NixOS/nixpkgs/issues/192396][Bug report Version 22.10.6]]
**** Notes
Erreur :
ERROR: Cannot download nextflow required file -- make sure you can connect to the internet
Alternatively you can try to download this file:
    https://www.nextflow.io/releases/v22.10.6/nextflow-22.10.6-all.jar
and save it as:
    .//nix/store/md2b1ah4d7ivj82k8xxap30dmdci00pa-nextflow-22.10.6/bin/.nextflow-wrapped
Dans la mise à jour, il y a la création d'un environnement virtuel qui casse l'exécution de nextflow (besoin de télécharger)
Fix = désactiver
**** KILL Patch NXF_OFFLINE=true
CLOSED: [2023-07-02 Sun 11:02] SCHEDULED: <2023-06-11 Sun>
** WAIT [[https://github.com/NixOS/nixpkgs/pull/249329][Multiqc]]
HG002,sanger-chr20,data/HG002-sanger-inserted-chr20_1.fq.gz,data/HG002-sanger-inserted-chr20_2.fq.gz
** TODO Mutalyzer
SCHEDULED: <2023-08-13 Sun>
Packaging faisable mais nombreux paquet python
** TODO Variant validator -> hgvs
C'est juste une interface autour d'hgvs mais il faut
- postgresql
- un accès ou télécharger des bases de données
  Dépendences
  s: wcwidth, pyee, pure-eval, ptyprocess, pickleshare, parsley, parse, fake-useragent, executing, backcall, appdirs, zipp, websockets, w3lib, urllib3, traitlets, tqdm, tabulate, sqlparse, soupsieve, six, pygments, psycopg2, prompt-toolkit, pexpect, parso, lxml, idna, humanfriendly, decorator, cython, cssselect, configparser, charset-normalizer, certifi, attrs, requests, pysam, pyquery, matplotlib-inline, jedi, importlib-metadata, coloredlogs, beautifulsoup4, asttokens, yoyo-migrations, stack-data, pyppeteer, bs4, bioutils, requests-html, ipython, biocommons.seqrepo, hgvs
** TODO SPIP T2T
*** DONE PR upstream
CLOSED: [2023-08-12 Sat 18:23] SCHEDULED: <2023-08-12 Sat 18:00>
*** DONE Mail R. Lemann
CLOSED: [2023-08-12 Sat 18:23] SCHEDULED: <2023-08-12 Sat 18:00>
*** TODO Mise à jour packages nix
** TODO VEP :vep:
*** DONE [[https://github.com/NixOS/nixpkgs/pull/185691][BioPerl]]
SCHEDULED: <2022-08-10 Wed>
/Entered on/ [2022-08-09 Tue 10:57]
PR submitted
*** TODO BioDBBBigFile
:PROPERTIES:
:ORDERED:  t
:END:
/Entered on/ [2022-08-10 Wed 14:28]
On utilise la dernière version de kent, donc plus de problème.
PRête à être mergé. Rebase faite<2023-07-02 Sun>
**** DONE Version de kent déjà packagée : forcer version  335
CLOSED: [2023-07-02 Sun 11:20]
***** KILL [[https://github.com/NixOS/nixpkgs/pull/206991][Restore building kent 404]]
CLOSED: [2023-05-06 Sat 17:40]
Review faite <2023-03-26 Sun> , atteinte merge]
Relancé <2023-05-06 Sat>
Kent 446 n'a pas ce problème donc PR inutile
***** DONE [[https://github.com/NixOS/nixpkgs/pull/223411][Ajouter les header to package]] (inc folder)
CLOSED: [2023-05-08 Mon 10:18] SCHEDULED: <2023-05-07 Sun>
Review à faire
https://github.com/NixOS/nixpkgs/pull/223411
Corrigé et plus besoin de la PR précédente
***** KILL [[https://github.com/NixOS/nixpkgs/pull/186462][BioDBBBigFile]] avec ces 2 changements
CLOSED: [2023-07-02 Sun 11:20]
**** KILL Version de kent déjà packagée : 404
CLOSED: [2023-03-27 Mon 16:43]
Compile mais les tests de passent pas
**** DONE Modifier selon PR https://github.com/NixOS/nixpkgs/pull/186462
CLOSED: [2023-07-30 Sun 22:01] SCHEDULED: <2023-07-30 Sun 20:00>
:LOGBOOK:
CLOCK: [2023-0

[6.16390]

[3.8221]

l#downloadAlt
- alt = séquences alternatives (utilisables)
- fix = patch (correction ou amélioration)
- random = séquence connue sur un chromosome mais non encore utilisée
** Pipelines prêt-à-l’emploi nextflow
Problème : nécessite singularity ou docker (ou conda)
Potentiellement utilisable avec nix...
** Validation : Quelles données de référence ?
Discussion avec Alexis
- Platinum genomes = génome seul
*** [[https://github.com/genome-in-a-bottle/giab_data_indexes][Genome in a bottle]]
  - NA12878 :
    - Illumina HiSeq Exome : fastq + capture en hg37
    - Illumina TruSeq Exome : bam, pas de capture
    - Exomes en hg37 https://zenodo.org/record/3597727 avec capture
      - HiSeq2000
      - NextSeq 500
      - HiSeq 2500
  - HG002,3,4
    - Illumina Whole Exome  : bam. le kit de capture est "Agilent SureSelect Human All Exon V5 kit" selon [[https://ftp-trace.ncbi.nlm.nih.gov/giab/ftp/data/AshkenazimTrio/analysis/OsloUniversityHospital_Exome_GATK_jointVC_11242015/README.txt][README]]. On il faut les régions [[https://kb.10xgenomics.com/hc/en-us/articles/115004150923-Where-can-I-find-the-Agilent-Target-BED-files-][selon ce site]]
      Un autre fichier est disponible (capture ???)
    https://ftp-trace.ncbi.nlm.nih.gov/giab/ftp/data/AshkenazimTrio/analysis/OsloUniversityHospital_Exome_GATK_jointVC_11242015/wex_Agilent_SureSelect_v05_b37.baits.slop50.merged.list
  "target region" +/- 50bp
    testé sur chr311780-312086 : ok
Autres technologies non adaptées au pipeline (vu avec Alexis)
*** [[https://www.illumina.com/platinumgenomes.html][Platinum genome
]] Que du génome « sequenced to 50x depth on a HiSeq 2000 system”
Genome possible
*** 1000 genomes
- intersection des capture + CCDS  [[id:b77e64fa-06a8-4ffa-8b5b-ab3fda684b61][Données brutes exome 1000 Genomes (fastq + capture)]]
- Broad instute : SureSelect human all exon v2 target capture kit : non disponible sur le site d'agilent (V6 ou plus)
*** Zone de capture
GIAB fourni le .bed pour l'exome . INfo : https://support.illumina.com/sequencing/sequencing_kits/nextera-rapid-capture-exome-kit/downloads.html
*** Valider la méthode
- 1000 genomes + SureSelect human all exon v2 target capture kit : non disponible sur le site d'agilent (V6 ou plus)
  https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-019-2928-9
- GIAB + liftover du fichire de capture en hg38
Ce qui est aussi fait par
https://bcbio-nextgen.readthedocs.io/en/stable/contents/germline_variants.html
Mais avec UCSC liftover
** Centogène
https://www.twistbioscience.com/node/23906
Bed non fourni pour exactement cette capture
On prend https://www.twistbioscience.com/resources/data-files/twist-alliance-vcgs-exome-401mb-bed-files
qui content la majeure partie
* Réunion
** <2023-08-10 Thu> Alexis
Ok pour bloquer le développment d'ici mardi prochain
Dév:
- pipeline jusque VEP en T2T + GRCh38
- ok pour valider spip T2T sur quelques variant => à intégrer au pipeline
- annotation :
  - ok pour mobidetails hg38
  - +OMIM T2T+ non
  - +franklin hg38+ non pour le moment
- métriques (fastq a minima) + rapport multiqc
- optionnel
  - reformater la sortie
- on abandonne
  - XAMScissors ave indel
  - parallélisation haplotype caller
  - spliceai à la vollée
  - pangolin
Test
- GIAB:
  - hg38: ok pour refaire les tests NA12878 avec données cento, sinon ok pour "c'est difficile" sur les 3 fichiers de capture
  - T2T: ok pour faire des tests rapides mais probablement pas assez de temps !
- patient de synthèse : variant cento confirém par sanger seuls
Résultats
- ok pour scale up bwa mem et haplotyecaller
Manuscrit
- validation de méthode : laisser tomber la version actuelle et faire comme strasbourg (cf ngs diag) dans la présentatino
- a envoyé le powerponit avec les références des différsences articles
- ok pour robo4 si résultat
- architecture cible = VM : 78 coeurs 54Go RAUM et 1To espace disque
Passage en production : ok pour présentation rapide du code
* Nixpkgs :nix:
** DONE GATK
CLOSED: [2023-05-06 Sat 08:51]
*** DONE [[https://github.com/NixOS/nixpkgs/pull/185819][Binaire]]
CLOSED: [2022-09-10 Sat 23:53] SCHEDULED: <2022-08-10 Wed>
/Entered on/ [2022-08-09 Tue 10:57]
PR submitted
*** KILL Corriger code pour utiliser source
CLOSED: [2022-09-11 Sun 22:05]
*** DONE Corriger PATH pour include java et python
CLOSED: [2022-10-11 Tue 11:46]
https://github.com/NixOS/nixpkgs/pull/191548
Review <2022-10-10 Mon> , corrigé dans la journée
*** DONE Update 4.3.0.0
CLOSED: [2023-04-13 Thu 09:01]
** HOLD Nextflow
*** KILL version script seule
CLOSED: [2023-04-01 Sat 18:29]
Fix pour SGE et nextflow
https://github.com/NixOS/nixpkgs/issues/192396
*** KILL Version avec gradle
CLOSED: [2022-10-09 Sun 22:51]
*** HOLD [[https://github.com/NixOS/nixpkgs/issues/192396][Bug report Version 22.10.6]]
**** Notes
Erreur :
ERROR: Cannot download nextflow required file -- make sure you can connect to the internet
Alternatively you can try to download this file:
    https://www.nextflow.io/releases/v22.10.6/nextflow-22.10.6-all.jar
and save it as:
    .//nix/store/md2b1ah4d7ivj82k8xxap30dmdci00pa-nextflow-22.10.6/bin/.nextflow-wrapped
Dans la mise à jour, il y a la création d'un environnement virtuel qui casse l'exécution de nextflow (besoin de télécharger)
Fix = désactiver
**** KILL Patch NXF_OFFLINE=true
CLOSED: [2023-07-02 Sun 11:02] SCHEDULED: <2023-06-11 Sun>
** WAIT [[https://github.com/NixOS/nixpkgs/pull/249329][Multiqc]]
HG002,sanger-chr20,data/HG002-sanger-inserted-chr20_1.fq.gz,data/HG002-sanger-inserted-chr20_2.fq.gz
** KILL Mutalyzer
CLOSED: [2023-08-16 Wed 19:07] SCHEDULED: <2023-08-13 Sun>
Packaging faisable mais nombreux paquet python
** TODO Variant validator -> hgvs
C'est juste une interface autour d'hgvs mais il faut
- postgresql
- un accès ou télécharger des bases de données
  Dépendences
  s: wcwidth, pyee, pure-eval, ptyprocess, pickleshare, parsley, parse, fake-useragent, executing, backcall, appdirs, zipp, websockets, w3lib, urllib3, traitlets, tqdm, tabulate, sqlparse, soupsieve, six, pygments, psycopg2, prompt-toolkit, pexpect, parso, lxml, idna, humanfriendly, decorator, cython, cssselect, configparser, charset-normalizer, certifi, attrs, requests, pysam, pyquery, matplotlib-inline, jedi, importlib-metadata, coloredlogs, beautifulsoup4, asttokens, yoyo-migrations, stack-data, pyppeteer, bs4, bioutils, requests-html, ipython, biocommons.seqrepo, hgvs
** TODO SPIP T2T
*** DONE PR upstream
CLOSED: [2023-08-12 Sat 18:23] SCHEDULED: <2023-08-12 Sat 18:00>
*** DONE Mail R. Lemann
CLOSED: [2023-08-12 Sat 18:23] SCHEDULED: <2023-08-12 Sat 18:00>
*** TODO Mise à jour packages nix
** TODO VEP :vep:
*** DONE [[https://github.com/NixOS/nixpkgs/pull/185691][BioPerl]]
SCHEDULED: <2022-08-10 Wed>
/Entered on/ [2022-08-09 Tue 10:57]
PR submitted
*** TODO BioDBBBigFile
:PROPERTIES:
:ORDERED:  t
:END:
/Entered on/ [2022-08-10 Wed 14:28]
On utilise la dernière version de kent, donc plus de problème.
PRête à être mergé. Rebase faite<2023-07-02 Sun>
**** DONE Version de kent déjà packagée : forcer version  335
CLOSED: [2023-07-02 Sun 11:20]
***** KILL [[https://github.com/NixOS/nixpkgs/pull/206991][Restore building kent 404]]
CLOSED: [2023-05-06 Sat 17:40]
Review faite <2023-03-26 Sun> , atteinte merge]
Relancé <2023-05-06 Sat>
Kent 446 n'a pas ce problème donc PR inutile
***** DONE [[https://github.com/NixOS/nixpkgs/pull/223411][Ajouter les header to package]] (inc folder)
CLOSED: [2023-05-08 Mon 10:18] SCHEDULED: <2023-05-07 Sun>
Review à faire
https://github.com/NixOS/nixpkgs/pull/223411
Corrigé et plus besoin de la PR précédente
***** KILL [[https://github.com/NixOS/nixpkgs/pull/186462][BioDBBBigFile]] avec ces 2 changements
CLOSED: [2023-07-02 Sun 11:20]
**** KILL Version de kent déjà packagée : 404
CLOSED: [2023-03-27 Mon 16:43]
Compile mais les tests de passent pas
**** DONE Modifier selon PR https://github.com/NixOS/nixpkgs/pull/186462
CLOSED: [2023-07-30 Sun 22:01] SCHEDULED: <2023-07-30 Sun 20:00>
:LOGBOOK:
CLOCK: [2023-0

Replacement in projects/bisonex.org at line 22 [7.35]

B:BD[2.7420] → [2.7420:8430]

∅:D[2.8430] → [8.8196:8240]

B:BD[8.8196] → [8.8196:8240]

∅:D[8.8240] → [9.8448:10109]

B:BD[9.8448] → [9.8448:10109]

∅:D[9.10109] → [10.8221:9061]

B:BD[10.8221] → [10.8221:9061]

∅:D[10.9061] → [11.28320:32957]

B:BD[11.28320] → [11.28320:32957]

, and CollectWgsMetrics
- Qualimap : alternative fastqc ? Non disponible nix
- Sentieon's WgsMetricsAlgo : propriétaire
- TIDDIT's cov : TIDIT = remaninement chromosomique
Sarek:
- alignment statistics : samtools stats, mosdepth
- QC : MultiQC
MultiQC : non disponible Nix
*** DONE FastqQC
CLOSED: [2023-08-15 Tue 21:43] SCHEDULED: <2023-08-13 Sun>
*** DONE Mosdepth
CLOSED: [2023-08-15 Tue 21:43] SCHEDULED: <2023-08-13 Sun>
Pour exomple, il faut le fichier de capture
subworkflows/local/bam_markduplicates/
*** DONE Samtools stats
CLOSED: [2023-08-15 Tue 21:43] SCHEDULED: <2023-08-13 Sun>
*** DONE [#B] Compte-redu exécution avec MultiQC
CLOSED: [2023-08-15 Tue 21:43] SCHEDULED: <2023-08-13 Sun>
** HOLD vérifier si normalisation
** TODO [#B] Vérification nomenclature hgvs :hgvs:
SCHEDULED: <2023-08-15 Tue>
*** TODO mutalyzer
SCHEDULED: <2023-08-13 Sun>
*** TODO API variantvalidator
SCHEDULED: <2023-08-13 Sun>
** DONE Exécution
CLOSED: [2022-09-13 Tue 21:37]
*** K
ILL test Bionix
*** KILL Implémenter execu
tion avec Nix ?
Voir https://academic.oup.com/gigascience/article/9/11/giaa121/5987272?login=false
pour un exemple.
Probablement plus simple d’utiliser Nix pour gestion de l’environnement et snakemake pour l’exécution
Pas d’accès internet depuis le cluster
*** DONE nextflow
CLOSED: [2022-09-13 Tue 21:37]
**** TODO Bug scheduler SGE
Le job se fait tuer car l'utilisateur n'est pas passé correctement à nextflow
***** DONE Forcer l'utilisateur à l'exécution
CLOSED: [2023-04-01 Sat 17:57]
NXF_OPTS=-D"user.name=alex"
***** DONE Vérifier si le problème persiste avec 22.10.6
CLOSED: [2023-04-01 Sat 18:38] SCHEDULED: <2023-04-01 Sat>
oui
***** KILL Packager l'utilisateur dans le programme ?
Mauvaise idée..
** TODO Preprocessing avec nextflow
*** TODO Map to reference
**** TODO Sample ID dans header
/Work/Users/apraga/bisonex/out/63003856_S135/preprocessing/baserecalibrator
*** DONE Mark duplicate
CLOSED: [2022-10-09 Sun 22:30]
*** DONE Recalibrate base quality score
CLOSED: [2022-10-09 Sun 22:30]
** DONE Variant calling avec Nextflow
CLOSED: [2022-11-19 Sat 21:34]
*** DONE Haplotype caller
CLOSED: [2022-10-09 Sun 22:40]
*** DONE Filter variants
CLOSED: [2022-10-09 Sun 22:40]
*** DONE Filter common snp not clinvar path
CLOSED: [2022-11-07 Mon 23:00]
Voir [[*common dbSNP not clinvar patho][common dbSNP not clinvar patho]]
*** DONE Filter variant only in consensual sequence
CLOSED: [2022-11-08 Tue 22:23]
*** DONE Filter technical variants
CLOSED: [2022-11-19 Sat 21:34]
*** DONE Utilise AVX pour accélerer l'exécution
CLOSED: [2023-04-29 Sat 15:46]
Sans cela, on a l'avertissement
#+begin_
quote
17:28:00.720 INFO  PairHMM - OpenMP multi-threaded AVX-accelerated native PairHMM implementation is not supported
17:28:00.721 INFO  NativeLibraryLoader - Loading libgkl_utils.so from jar:file:/nix/store/cy9ckxqwrkifx7wf02hm4ww1p6lnbxg9-gatk-4.2.4.1/bin/gatk-package-4.2.4.1-local.jar!/com/intel/gkl/native/libgkl_utils.so
17:28:00.733 WARN  NativeLibraryLoader - Unable to load libgkl_utils.so from native/libgkl_utils.so (/Work/Users/apraga/bisonex/out/NA12878_NIST7035/preprocessing/applybqsr/libgkl_utils821485189051585397.so: libgomp.so.1: cannot open shared object file: No such file or directory)
17:28:00.733 WARN  IntelPairHmm - Intel GKL Utils not loaded
17:28:00.733 WARN  PairHMM - ***WARNING: Machine does not have the AVX instruction set support needed for the accelerated AVX PairHmm. Falling back to the MUCH slow
er LOGLESS_CACHING implementation!
17:28:00.763 INFO  ProgressMeter - Starting traversal
#+end_quote
libgomp.so est fourni par gcc donc il faut charger le module
 module load gcc@11.3.0/gcc-12.1.0
** KILL Utiliser subworkflow
CLOSED: [2023-04-02 Sun 18:08]
Notre version permet d'être plus souple
*** KILL Alignement
CLOSED: [2023-04-02 Sun 18:08] SCHEDULED: <2023-04-05 Wed>
*** KILL Vep
CLOSED: [2023-04-02 Sun 18:08] SCHEDULED: <2023-04-05 Wed>
vcf_annotate_ensemblvep
** TODO Annotation avec nextflow :annotation:
*** KILL VEP : --gene-phenotype ?
CLOSED: [2023-04-18 mar. 18:32]
Vu avec alexis : bases de données non à jour
https://www.ensembl.org/info/genome/variation/phenotype/sources_phenotype_documentation.html
*** DONE plugin VEP
CLOSED: [2023-04-18 mar. 18:32]
Cloner dépôt git avec plugin
Puis utiliser --dir_plugins
*** HOLD Utiliser code d’Alexis
*** TODO Nouvelle version avec VEP
Example avec --custom
https://www.ensembl.org/info/docs/tools/vep/script/vep_custom.html
**** DONE Ajout spliceAI
CLOSED: [2023-05-18 Thu 11:02] SCHEDULED: <2023-04-30 Sun>
plugin VEP
***** DONE Télécharger les données
CLOSED: [2023-05-11 Thu 19:01]
Difficile d'automatiser, le lien est temporaire...
***** DONE PLugin
CLOSED: [2023-05-11 Thu 20:16]
***** DONE Séparer score en plusieurs colonnes
CLOSED: [2023-05-11 Thu 20:16]
Test avec ce fichier pour avoir une ligne avec annotation et une ligne sans
#CHROM	POS	ID	REF	ALT
1	9091	.	A	C
1	69091	.	A	C
et
#+begin_src sh
rm -f postvep.tsv* && vep -i testspliceai.vcf.gz -o postvep.tsv --tab  --dir 109 --merged --pick --use_given_ref   --offline  --plugin SpliceAI,snv=spliceai_scores.raw.snv.hg38.vcf.gz,indel=spliceai_scores.raw.indel.hg38.vcf.gz
#+end_src
#+begin_src
$ bgzip postvep.tsv
$ python spliceai.py
$ cat postvep2.tsv
,variation,Location,Allele,Gene,Feature,Feature_type,Consequence,cDNA_position,CDS_position,Protein_position,Amino_acids,Codons,Existing_variation,IMPACT,DISTANCE,STRAND,FLAGS,REFSEQ_MATCH,SOURCE,REFSEQ_OFFSET,SpliceAI_AG,SpliceAI_AL,SpliceAI_DG,SpliceAI_DL
0,1_9091_A/C,1:9091,C,ENSG00000290825,ENST00000456328,Transcript,upstream_gene_variant,-,-,-,-,-,-,MODIFIER,2778,1,-,-,Ensembl,-,,,,
1,1_69091_A/C,1:69091,C,ENSG00000186092,ENST00000641515,Transcript,missense_variant,124,64,22,M/L,Atg/Ctg,-,MODERATE,-,1,-,-,Ensembl,-,0.01,0.00,0.00,0.01
#+end_src
Test
cp work/bf/437ae511958509e43072f032f4d495/small.tab.gz tests/vep-spip.tab.gz
cp work/d5/3b1244b5ae83d54409ee0d456e8c55/small_cadd.tab.gz tests/vep-cadd-splice.tab.gz
**** TODO Package Nix spliceAI ?
nix profile install nixpkgs#python3Packages.tensorflow
+ ajouter dépendencs ("grep import" ou cnad)
**** TODO Ajout LOEUF et pli
plugin VEP
**** TODO NMD
**** KILL Ajout LOEUF
CLOSED: [2023-04-19 mer. 16:32]
plugin VEP
**** DONE Spip
CLOSED: [2023-05-01 Mon 23:07] SCHEDULED: <2023-04-30 Sun>
BED ne semble pas bien marcher (il faut définir une zone)
VCF : trop d’information
Attention, plusieurs transcripts mais résultats identiques. On supprimer les doublons
***** DONE interpretation + score + intervalle de confiance séparé
CLOSED: [2023-05-01 Mon 23:07] SCHEDULED: <2023-04-30 Sun>
Tests :
dans tests/
vep -i 63004925-small.vcf -o postvep.vcf --vcf --fasta genomeRef.fna --dir 109 --merged --pick  --offline --custom ../script/spip_annotation.vcf.gz,SPIP,vcf,exact,0,spipInterp,spipScore,spipConfidence
***** DONE Score
CLOSED: [2023-04-22 Sat 15:30]
**** DONE CADD: remplacer par plugin VEP
CLOSED: [2023-05-07 Sun 14:45] SCHEDULED: <2023-05-07 Sun>
***** Test
#+begin_src
vep  -i test.vcf  -o lol.vcf --offline --dir  /Work/Projects/bisonex/data/vep/GRCh38/ --merged --vcf --fasta /Work/Projects/bisonex/data/genome/GRCh38.p13/genomeRef.fna --plugin CADD,/Work/Users/apraga/bisonex/work/13/9287a7fef17ab9365f5696f20710cd/gnomad.genomes.r3.0.snv.tsv.gz,/Work/Users/apraga/bisonex/work/13/9287a7fef17ab9365f5696f20710cd/gnomad.genomes.r3.0.indel.tsv.gz  --dir_plugins ../VEP_plugins/ -v
#+end_src
Test
#+begin_src sh
vep --id "1  230710048 230710048 A/G 1"   --offline --dir  /Work/Projects/bisonex/data/vep/GRCh38/ --merged --vcf --fasta /Work/Projects/bisonex/data/genome/GRCh38.p13/genomeRef.fna --plugin CADD,/Work/Users/apraga/bisonex/work/13/9287a7fef17ab9365f5696f20710cd/gnomad.genomes.r3.0.snv.tsv.gz,/Work/Users/apraga/bisonex/work/13/9287a7fef17ab9365f5696f20710cd/gnomad.genomes.r3.0.indel.tsv.gz  --hgvsg --plugin pLI --plugin LOEUF -o lol
#+end_src
CSQ=G|missense_variant|MODERATE|AGT|ENSG00000135744|Transcript|ENST00000366667|protein_coding|2/5||||843|776|25

[2.7420]

[11.32957]

, and CollectWgsMetrics
- Qualimap : alternative fastqc ? Non disponible nix
- Sentieon's WgsMetricsAlgo : propriétaire
- TIDDIT's cov : TIDIT = remaninement chromosomique
Sarek:
- alignment statistics : samtools stats, mosdepth
- QC : MultiQC
MultiQC : non disponible Nix
*** DONE FastqQC
CLOSED: [2023-08-15 Tue 21:43] SCHEDULED: <2023-08-13 Sun>
*** DONE Mosdepth
CLOSED: [2023-08-15 Tue 21:43] SCHEDULED: <2023-08-13 Sun>
Pour exomple, il faut le fichier de capture
subworkflows/local/bam_markduplicates/
*** DONE Samtools stats
CLOSED: [2023-08-15 Tue 21:43] SCHEDULED: <2023-08-13 Sun>
*** DONE [#B] Compte-redu exécution avec MultiQC
CLOSED: [2023-08-15 Tue 21:43] SCHEDULED: <2023-08-13 Sun>
** HOLD vérifier si normalisation
** KILL [#B] Vérification nomenclature hgvs :hgvs:
CLOSED: [2023-08-16 Wed 19:07] SCHEDULED: <2023-08-15 Tue>
*** KILL mutalyzer
CLOSED: [2023-08-16 Wed 19:07] SCHEDULED: <2023-08-13 Sun>
*** KILL API variantvalidator
CLOSED: [2023-08-16 Wed 19:07] SCHEDULED: <2023-08-13 Sun>
** DONE Exécution
CLOSED: [2022-09-13 Tue 21:37]
*** KILL test Bionix
*** KILL Implémenter execution avec Nix ?
Voir https://academic.oup.com/gigascience/article/9/11/giaa121/5987272?login=false
pour un exemple.
Probablement plus simple d’utiliser Nix pour gestion de l’environnement et snakemake pour l’exécution
Pas d’accès internet depuis le cluster
*** DONE nextflow
CLOSED: [2022-09-13 Tue 21:37]
**** TODO Bug scheduler SGE
Le job se fait tuer car l'utilisateur n'est pas passé correctement à nextflow
***** DONE Forcer l'utilisateur à l'exécution
CLOSED: [2023-04-01 Sat 17:57]
NXF_OPTS=-D"user.name=alex"
***** DONE Vérifier si le problème persiste avec 22.10.6
CLOSED: [2023-04-01 Sat 18:38] SCHEDULED: <2023-04-01 Sat>
oui
***** KILL Packager l'utilisateur dans le programme ?
Mauvaise idée..
** TODO Preprocessing avec nextflow
*** TODO Map to reference
**** TODO Sample ID dans header
/Work/Users/apraga/bisonex/out/63003856_S135/preprocessing/baserecalibrator
*** DONE Mark duplicate
CLOSED: [2022-10-09 Sun 22:30]
*** DONE Recalibrate base quality score
CLOSED: [2022-10-09 Sun 22:30]
** DONE Variant calling avec Nextflow
CLOSED: [2022-11-19 Sat 21:34]
*** DONE Haplotype caller
CLOSED: [2022-10-09 Sun 22:40]
*** DONE Filter variants
CLOSED: [2022-10-09 Sun 22:40]
*** DONE Filter common snp not clinvar path
CLOSED: [2022-11-07 Mon 23:00]
Voir [[*common dbSNP not clinvar patho][common dbSNP not clinvar patho]]
*** DONE Filter variant only in consensual sequence
CLOSED: [2022-11-08 Tue 22:23]
*** DONE Filter technical variants
CLOSED: [2022-11-19 Sat 21:34]
*** DONE Utilise AVX pour accélerer l'exécution
CLOSED: [2023-04-29 Sat 15:46]
Sans cela, on a l'avertissement
#+begin_quote
17:28:00.720 INFO  PairHMM - OpenMP multi-threaded AVX-accelerated native PairHMM implementation is not supported
17:28:00.721 INFO  NativeLibraryLoader - Loading libgkl_utils.so from jar:file:/nix/store/cy9ckxqwrkifx7wf02hm4ww1p6lnbxg9-gatk-4.2.4.1/bin/gatk-package-4.2.4.1-local.jar!/com/intel/gkl/native/libgkl_utils.so
17:28:00.733 WARN  NativeLibraryLoader - Unable to load libgkl_utils.so from native/libgkl_utils.so (/Work/Users/apraga/bisonex/out/NA12878_NIST7035/preprocessing/applybqsr/libgkl_utils821485189051585397.so: libgomp.so.1: cannot open shared object file: No such file or directory)
17:28:00.733 WARN  IntelPairHmm - Intel GKL Utils not loaded
17:28:00.733 WARN  PairHMM - ***WARNING: Machine does not have the AVX instruction set support needed for the accelerated AVX PairHmm. Falling back to the MUCH slower LOGLESS_CACHING implementation!
17:28:00.763 INFO  ProgressMeter - Starting traversal
#+end_quote
libgomp.so est fourni par gcc donc il faut charger le module
 module load gcc@11.3.0/gcc-12.1.0
** KILL Utiliser subworkflow
CLOSED: [2023-04-02 Sun 18:08]
Notre version permet d'être plus souple
*** KILL Alignement
CLOSED: [2023-04-02 Sun 18:08] SCHEDULED: <2023-04-05 Wed>
*** KILL Vep
CLOSED: [2023-04-02 Sun 18:08] SCHEDULED: <2023-04-05 Wed>
vcf_annotate_ensemblvep
** TODO Annotation avec nextflow :annotation:
*** KILL VEP : --gene-phenotype ?
CLOSED: [2023-04-18 mar. 18:32]
Vu avec alexis : bases de données non à jour
https://www.ensembl.org/info/genome/variation/phenotype/sources_phenotype_documentation.html
*** DONE plugin VEP
CLOSED: [2023-04-18 mar. 18:32]
Cloner dépôt git avec plugin
Puis utiliser --dir_plugins
*** HOLD Utiliser code d’Alexis
*** TODO Nouvelle version avec VEP
Example avec --custom
https://www.ensembl.org/info/docs/tools/vep/script/vep_custom.html
**** DONE Ajout spliceAI
CLOSED: [2023-05-18 Thu 11:02] SCHEDULED: <2023-04-30 Sun>
plugin VEP
***** DONE Télécharger les données
CLOSED: [2023-05-11 Thu 19:01]
Difficile d'automatiser, le lien est temporaire...
***** DONE PLugin
CLOSED: [2023-05-11 Thu 20:16]
***** DONE Séparer score en plusieurs colonnes
CLOSED: [2023-05-11 Thu 20:16]
Test avec ce fichier pour avoir une ligne avec annotation et une ligne sans
#CHROM	POS	ID	REF	ALT
1	9091	.	A	C
1	69091	.	A	C
et
#+begin_src sh
rm -f postvep.tsv* && vep -i testspliceai.vcf.gz -o postvep.tsv --tab  --dir 109 --merged --pick --use_given_ref   --offline  --plugin SpliceAI,snv=spliceai_scores.raw.snv.hg38.vcf.gz,indel=spliceai_scores.raw.indel.hg38.vcf.gz
#+end_src
#+begin_src
$ bgzip postvep.tsv
$ python spliceai.py
$ cat postvep2.tsv
,variation,Location,Allele,Gene,Feature,Feature_type,Consequence,cDNA_position,CDS_position,Protein_position,Amino_acids,Codons,Existing_variation,IMPACT,DISTANCE,STRAND,FLAGS,REFSEQ_MATCH,SOURCE,REFSEQ_OFFSET,SpliceAI_AG,SpliceAI_AL,SpliceAI_DG,SpliceAI_DL
0,1_9091_A/C,1:9091,C,ENSG00000290825,ENST00000456328,Transcript,upstream_gene_variant,-,-,-,-,-,-,MODIFIER,2778,1,-,-,Ensembl,-,,,,
1,1_69091_A/C,1:69091,C,ENSG00000186092,ENST00000641515,Transcript,missense_variant,124,64,22,M/L,Atg/Ctg,-,MODERATE,-,1,-,-,Ensembl,-,0.01,0.00,0.00,0.01
#+end_src
Test
cp work/bf/437ae511958509e43072f032f4d495/small.tab.gz tests/vep-spip.tab.gz
cp work/d5/3b1244b5ae83d54409ee0d456e8c55/small_cadd.tab.gz tests/vep-cadd-splice.tab.gz
**** TODO Package Nix spliceAI ?
nix profile install nixpkgs#python3Packages.tensorflow
+ ajouter dépendencs ("grep import" ou cnad)
**** TODO Ajout LOEUF et pli
plugin VEP
**** TODO NMD
**** KILL Ajout LOEUF
CLOSED: [2023-04-19 mer. 16:32]
plugin VEP
**** DONE Spip
CLOSED: [2023-05-01 Mon 23:07] SCHEDULED: <2023-04-30 Sun>
BED ne semble pas bien marcher (il faut définir une zone)
VCF : trop d’information
Attention, plusieurs transcripts mais résultats identiques. On supprimer les doublons
***** DONE interpretation + score + intervalle de confiance séparé
CLOSED: [2023-05-01 Mon 23:07] SCHEDULED: <2023-04-30 Sun>
Tests :
dans tests/
vep -i 63004925-small.vcf -o postvep.vcf --vcf --fasta genomeRef.fna --dir 109 --merged --pick  --offline --custom ../script/spip_annotation.vcf.gz,SPIP,vcf,exact,0,spipInterp,spipScore,spipConfidence
***** DONE Score
CLOSED: [2023-04-22 Sat 15:30]
**** DONE CADD: remplacer par plugin VEP
CLOSED: [2023-05-07 Sun 14:45] SCHEDULED: <2023-05-07 Sun>
***** Test
#+begin_src
vep  -i test.vcf  -o lol.vcf --offline --dir  /Work/Projects/bisonex/data/vep/GRCh38/ --merged --vcf --fasta /Work/Projects/bisonex/data/genome/GRCh38.p13/genomeRef.fna --plugin CADD,/Work/Users/apraga/bisonex/work/13/9287a7fef17ab9365f5696f20710cd/gnomad.genomes.r3.0.snv.tsv.gz,/Work/Users/apraga/bisonex/work/13/9287a7fef17ab9365f5696f20710cd/gnomad.genomes.r3.0.indel.tsv.gz  --dir_plugins ../VEP_plugins/ -v
#+end_src
Test
#+begin_src sh
vep --id "1  230710048 230710048 A/G 1"   --offline --dir  /Work/Projects/bisonex/data/vep/GRCh38/ --merged --vcf --fasta /Work/Projects/bisonex/data/genome/GRCh38.p13/genomeRef.fna --plugin CADD,/Work/Users/apraga/bisonex/work/13/9287a7fef17ab9365f5696f20710cd/gnomad.genomes.r3.0.snv.tsv.gz,/Work/Users/apraga/bisonex/work/13/9287a7fef17ab9365f5696f20710cd/gnomad.genomes.r3.0.indel.tsv.gz  --hgvsg --plugin pLI --plugin LOEUF -o lol
#+end_src
CSQ=G|missense_variant|MODERATE|AGT|ENSG00000135744|Transcript|ENST00000366667|protein_coding|2/5||||843|776|25

Replacement in projects/bisonex.org at line 57 [7.35]

B:BD[12.15462] → [12.15462:16506]

∅:D[12.16506] → [10.14832:17226]

B:BD[10.14832] → [10.14832:17226]

∅:D[10.17226] → [11.52897:57651]

B:BD[11.52897] → [11.52897:57651]

écupérer la séquence en T2T et GRCh38 via le nom du read dans le bam
   3. si la séquence en T2T modifiée par le variant est "identique" à celle en GRCh38, alors on ignore ce faux positif
Note: on ignore les reads qui ont changé de chromosome entre les version
******* DONE Résultat préliminaire
CLOSED: [2023-07-23 Sun 14:30]
cf [[file:~/roam/research/bisonex/code/giab/giab-corrected.csv][script julia]]
3498 faux positifs en moins, soit 0.89 sensibilité
julia> tp=15479
julia> fp=5277
julia> tp/(tp+fp)
0.7457602620928888
julia> tp/(tp+(fp-3498))
0.8969173716537258
On est toujours en dessous des 97%
******* HOLD Corriger proprement VCF ou résultats Happy
******* TODO Adapter pour gérer plusieurs variants par read
****** PROJ Méthodologie du pangenome
***** KILL Mail Yannis
CLOSED: [2023-07-08 Sat 10:44]
***** DONE Mail GIAB pour version T2T
CLOSED: [2023-07-07 Fri 18:37]
**** TODO HG002 :hg002:T2T:
**** TODO HG003 :hg003:T2T:
**** TODO HG004 :hg004:T2T:
**** DONE Plot : ashkenazim trio :
hg38:
CLOSED: [2023-07-30 Sun 16:49] SCHEDULED: <2023-07-30 Sun 15:00>
:LOGBOOK:
CLOCK: [2023-07-30 Sun 16:06]--[2023-07-30 Sun 16:35] =>  0:29
CLOCK: [2023-07-30 Sun 15:39]--[2023-07-30 Sun 15:40] =>  0:01
:END:
/Entered on/ [2023-04-16 Sun 17:29]
Refaire résultats
**** DONE Mail Paul sur les résultat ashkenazim +/- centogene
CLOSED: [2023-08-06 Sun 20:24] SCHEDULED: <2023-08-06 Sun>
**** DONE Relancer comparaison GIAB avec GATK 4.4.0
CLOSED: [2023-08-12 Sat 15:55]
/Entered on/ [2023-08-03 Thu 12:42]
*** KILL Platinum genome
CLOSED: [2023-06-14 Wed 22:37]
https://emea.illumina.com/platinumgenomes.html
*** TODO Séquencer NA12878 :cento:hg001:
Discussion avec Paul : sous-traitant ne nous donnera pas les données, il faut commander l'ADN
**** DONE ADN commandé
CLOSED: [2023-06-30 Fri 22:29]
**** DONE Sauvegarder les données brutes
CLOSED: [2023-07-30 Sun 14:22] SCHEDULED: <2023-07-19 Wed>
K, scality, S
**** KILL Récupérer le fichier de capture
CLOSED: [2023-07-30 Sun 14:25] SCHEDULED: <2023-07-23 Sun>
Candidats donnés dans publication https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8354858/
#+begin_quote
In short, the Nextera Rapid Capture Exome Kit (Illumina, San Diego, CA), the SureSelect Human All Exon kit (Agilent, Santa Clara, CA) or the Twist Human Core Exome was used for enrichment, and a Nextseq500, HiSeq4000, or Novoseq 6000 (Illumina) instrument was used for the actual sequencing, with the average coverage targeted to at least 100× or at least 98% of the target DNA covered 20×.
#+end_quote
Par défaut, on utilisera https://www.twistbioscience.com/products/ngs/alliance-panels#tab-3
ANnonce récente pour nouveau panel Twist : https://www.centogene.com/news-events/news/newsdetails/twist-bioscience-and-centogene-launch-three-panels-to-advance-rare-disease-and-hereditary-cancer-research-and-support-diagnostics
Masi pas de fichier BED
***** DONE Mail centogène
CLOSED: [2023-07-30 Sun 14:22] DEADLINE: <2023-07-23 Sun>
**** DONE Tester Nextera Rapid Capture Exome v1.2 (hg19) :giab:
CLOSED: [2023-08-06 Sun 19:05] SCHEDULED: <2023-08-03 Thu 19:00>
https://support.illumina.com/downloads/nextera-rapid-capture-exome-v1-2-product-files.html
***** DONE Liftover capture
CLOSED: [2023-08-06 Sun 18:30] SCHEDULED: <2023-08-06 Sun>
#+begin_src sh
 nextflow run -profile standard,helios workflows/lift-nextera-capture.n
f  -lib lib
#+end_src
Vérification rapide : ok
***** DONE Run
CLOSED: [2023-08-06 Sun 19:05] SCHEDULED: <2023-08-06 Sun>
#+begin_src sh
 nextflow run workflows/compareVCF.nf -profile standard,helios --query=out/2300346867_NA12878-63118093_S260-GRCh38/callVariant/haplotypecaller/2300346867_NA12878-63118093_S260-GRCh38.vcf.gz --outdir=out/2300346867_NA12878-63118093_S260-GRCh38/happy-nextera-lifted/ --compare=happy -lib lib --capture=capture/nexterarapidcapture_exome_targetedregions_v1.2-nochrM_lifted.bed  --id=HG001 --genome=GRCh38
#+end_src
**** DONE Tester Agilent SureSelect All Exon V8 (hg38) :giab:
CLOSED: [2023-07-31 Mon 23:09] SCHEDULED: <2023-07-31 Mon>
https://earray.chem.agilent.com/suredesign/index.htm
"Find design"
"Agilent catalog"
Fichiers:
- Regions.bed: Targeted exon intervals, curated and targeted by Agilent Technologies
- MergedProbes.bed: Merged probes for targeted enrichment of exons described in Regions.bed
- Covered.bed: Merged probes and sequences with 95% homology or above
- Padded.bed: Merged probes and sequences with 95% homology or above extended 50 bp at each side
- AllTracks.bed: Targeted regions and covered tracks
 #+begin_src sh
nextflow run workflows/compareVCF.nf -profile standard,helios --query=out/2300346867_63118093_NA12878-GRCh38/callVariant/haplotypecaller/2300346867_63118093_NA12878-GRCh38.vcf.gz --outdir=out/2300346867_63118093_NA12878-GRCh38/happy/ --compare=happy -lib lib --capture=capture/Agilent_SureSelect_All_Exons_v8_hg38_Regions.bed  --id=HG001 --genome=GRCh38
 #+end_src
| Type  | Filter | TRUTH.TOTAL | TRUTH.TP | TRUTH.FN | QUERY.TOTAL | QUERY.FP | QUERY.UNK | FP.gt | FP.al | METRIC.Recall | METRIC.Precision | METRIC.Frac_NA | METRIC.F1_Score | TRUTH.TOTAL.TiTv_ratio | QUERY.TOTAL.TiTv_ratio | TRUTH.TOTAL.het_hom_ratio | QUERY.TOTAL.het_hom_ratio |
| INDEL | ALL    |         423 |      395 |       28 |         915 |      108 |       405 |     4 |    13 |      0.933806 |         0.788235 |       0.442623 |        0.854868 |                        |                        |        1.7012987012987013 |        2.7916666666666665 |
| INDEL | PASS   |         423 |      395 |       28 |         915 |      108 |       405 |     4 |    13 |      0.933806 |         0.788235 |       0.442623 |        0.854868 |                        |                        |        1.7012987012987013 |        2.7916666666666665 |
| SNP   | ALL    |       20984 |    20600 |      384 |       26080 |      780 |      4703 |    62 |    10 |        0.9817 |         0.963512 |        0.18033 |        0.972521 |     3.0499710592321048 |     2.7596541786743516 |          1.58256372367935 |        1.8978207694018234 |
| SNP   | PASS   |       20984 |    20600 |      384 |       26080 |      780 |      4703 |    62 |    10 |        0.9817 |         0.963512 |        0.18033 |        0.972521 |     3.0499710592321048 |     2.7596541786743516 |          1.58256372367935 |        1.8978207694018234 |
**** DONE Test Twist Human core Exome (hg38):giab:
CLOSED: [2023-08-01 Tue 23:16] SCHEDULED: <202 3-08-02 Wed>
https://www.twistbioscience.com/resources/data-files/ngs-human-core-exome-panel-bed-file
#+begin_src
nextflow run workflows/compareVCF.nf -profile standard,helios --query=out/2300346867_63118093_NA12878-GRCh38/callVariant/haplotypecaller/2300346867_63118093_NA12878-GRCh38.vcf.gz --outdir=out/2300346867_63118093_NA12878-GRCh38/happy-twist-exome-core/ --compare=happy -lib lib --capture=capture/Twist_Exome_Core_Covered_Targets_hg38.bed  --id=HG001 --genome=GRCh38 -bg
#+end_src
| Type  | Filter | TRUTH.TOTAL | TRUTH.TP | TRUTH.FN | QUERY.TOTAL | QUERY.FP | QUERY.UNK | FP.gt | FP.al | METRIC.Recall | METRIC.Precision | METRIC.Frac_NA | METRIC.F1_Score | TRUTH.TOTAL.TiTv_ratio | QUERY.TOTAL.TiTv_ratio | TRUTH.TOTAL.het_hom_ratio | QUERY.TOTAL.het_hom_ratio |
| INDEL | ALL    |         328 |      313 |       15 |         722 |       95 |       309 |     4 |    13 |      0.954268 |         0.769976 |       0.427978 |        0.852273 |                        |                        |        1.8584070796460177 |        2.8967391304347827 |
| INDEL | PASS   |         328 |      313 |       15 |         722 |       95 |       309 |     4 |    13 |      0.954268 |         0.769976 |       0.427978 |        0.852273 |                        |                        |        1.8584070796460177 |        2.8967391304347827 |
| SNP   | ALL    |       19198 |    18962 |      236 |       23381 |      684 |      3738 |    48 |    10 |      0.987707 |         0.965178 |       0.159873 |        0.976313 |     3.1034188034188035 |      2.859264147830391 |        1.5669565217391304 |        1.8578767123287672 |
| SNP   | PASS   |

[12.15462]

[11.57651]

écupérer la séquence en T2T et GRCh38 via le nom du read dans le bam
   3. si la séquence en T2T modifiée par le variant est "identique" à celle en GRCh38, alors on ignore ce faux positif
Note: on ignore les reads qui ont changé de chromosome entre les version
******* DONE Résultat préliminaire
CLOSED: [2023-07-23 Sun 14:30]
cf [[file:~/roam/research/bisonex/code/giab/giab-corrected.csv][script julia]]
3498 faux positifs en moins, soit 0.89 sensibilité
julia> tp=15479
julia> fp=5277
julia> tp/(tp+fp)
0.7457602620928888
julia> tp/(tp+(fp-3498))
0.8969173716537258
On est toujours en dessous des 97%
******* HOLD Corriger proprement VCF ou résultats Happy
******* TODO Adapter pour gérer plusieurs variants par read
****** KILL Méthodologie du pangenome
CLOSED: [2023-08-16 Wed 19:08]
***** KILL Mail Yannis
CLOSED: [2023-07-08 Sat 10:44]
***** DONE Mail GIAB pour version T2T
CLOSED: [2023-07-07 Fri 18:37]
**** TODO HG002 :hg002:T2T:
**** TODO HG003 :hg003:T2T:
**** TODO HG004 :hg004:T2T:
**** DONE Plot : ashkenazim trio :hg38:
CLOSED: [2023-07-30 Sun 16:49] SCHEDULED: <2023-07-30 Sun 15:00>
:LOGBOOK:
CLOCK: [2023-07-30 Sun 16:06]--[2023-07-30 Sun 16:35] =>  0:29
CLOCK: [2023-07-30 Sun 15:39]--[2023-07-30 Sun 15:40] =>  0:01
:END:
/Entered on/ [2023-04-16 Sun 17:29]
Refaire résultats
**** DONE Mail Paul sur les résultat ashkenazim +/- centogene
CLOSED: [2023-08-06 Sun 20:24] SCHEDULED: <2023-08-06 Sun>
**** DONE Relancer comparaison GIAB avec GATK 4.4.0
CLOSED: [2023-08-12 Sat 15:55]
/Entered on/ [2023-08-03 Thu 12:42]
*** KILL Platinum genome
CLOSED: [2023-06-14 Wed 22:37]
https://emea.illumina.com/platinumgenomes.html
*** TODO Séquencer NA12878 :cento:hg001:
Discussion avec Paul : sous-traitant ne nous donnera pas les données, il faut commander l'ADN
**** DONE ADN commandé
CLOSED: [2023-06-30 Fri 22:29]
**** DONE Sauvegarder les données brutes
CLOSED: [2023-07-30 Sun 14:22] SCHEDULED: <2023-07-19 Wed>
K, scality, S
**** KILL Récupérer le fichier de capture
CLOSED: [2023-07-30 Sun 14:25] SCHEDULED: <2023-07-23 Sun>
Candidats donnés dans publication https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8354858/
#+begin_quote
In short, the Nextera Rapid Capture Exome Kit (Illumina, San Diego, CA), the SureSelect Human All Exon kit (Agilent, Santa Clara, CA) or the Twist Human Core Exome was used for enrichment, and a Nextseq500, HiSeq4000, or Novoseq 6000 (Illumina) instrument was used for the actual sequencing, with the average coverage targeted to at least 100× or at least 98% of the target DNA covered 20×.
#+end_quote
Par défaut, on utilisera https://www.twistbioscience.com/products/ngs/alliance-panels#tab-3
ANnonce récente pour nouveau panel Twist : https://www.centogene.com/news-events/news/newsdetails/twist-bioscience-and-centogene-launch-three-panels-to-advance-rare-disease-and-hereditary-cancer-research-and-support-diagnostics
Masi pas de fichier BED
***** DONE Mail centogène
CLOSED: [2023-07-30 Sun 14:22] DEADLINE: <2023-07-23 Sun>
**** DONE Tester Nextera Rapid Capture Exome v1.2 (hg19) :giab:
CLOSED: [2023-08-06 Sun 19:05] SCHEDULED: <2023-08-03 Thu 19:00>
https://support.illumina.com/downloads/nextera-rapid-capture-exome-v1-2-product-files.html
***** DONE Liftover capture
CLOSED: [2023-08-06 Sun 18:30] SCHEDULED: <2023-08-06 Sun>
#+begin_src sh
 nextflow run -profile standard,helios workflows/lift-nextera-capture.nf  -lib lib
#+end_src
Vérification rapide : ok
***** DONE Run
CLOSED: [2023-08-06 Sun 19:05] SCHEDULED: <2023-08-06 Sun>
#+begin_src sh
 nextflow run workflows/compareVCF.nf -profile standard,helios --query=out/2300346867_NA12878-63118093_S260-GRCh38/callVariant/haplotypecaller/2300346867_NA12878-63118093_S260-GRCh38.vcf.gz --outdir=out/2300346867_NA12878-63118093_S260-GRCh38/happy-nextera-lifted/ --compare=happy -lib lib --capture=capture/nexterarapidcapture_exome_targetedregions_v1.2-nochrM_lifted.bed  --id=HG001 --genome=GRCh38
#+end_src
**** DONE Tester Agilent SureSelect All Exon V8 (hg38) :giab:
CLOSED: [2023-07-31 Mon 23:09] SCHEDULED: <2023-07-31 Mon>
https://earray.chem.agilent.com/suredesign/index.htm
"Find design"
"Agilent catalog"
Fichiers:
- Regions.bed: Targeted exon intervals, curated and targeted by Agilent Technologies
- MergedProbes.bed: Merged probes for targeted enrichment of exons described in Regions.bed
- Covered.bed: Merged probes and sequences with 95% homology or above
- Padded.bed: Merged probes and sequences with 95% homology or above extended 50 bp at each side
- AllTracks.bed: Targeted regions and covered tracks
 #+begin_src sh
nextflow run workflows/compareVCF.nf -profile standard,helios --query=out/2300346867_63118093_NA12878-GRCh38/callVariant/haplotypecaller/2300346867_63118093_NA12878-GRCh38.vcf.gz --outdir=out/2300346867_63118093_NA12878-GRCh38/happy/ --compare=happy -lib lib --capture=capture/Agilent_SureSelect_All_Exons_v8_hg38_Regions.bed  --id=HG001 --genome=GRCh38
 #+end_src
| Type  | Filter | TRUTH.TOTAL | TRUTH.TP | TRUTH.FN | QUERY.TOTAL | QUERY.FP | QUERY.UNK | FP.gt | FP.al | METRIC.Recall | METRIC.Precision | METRIC.Frac_NA | METRIC.F1_Score | TRUTH.TOTAL.TiTv_ratio | QUERY.TOTAL.TiTv_ratio | TRUTH.TOTAL.het_hom_ratio | QUERY.TOTAL.het_hom_ratio |
| INDEL | ALL    |         423 |      395 |       28 |         915 |      108 |       405 |     4 |    13 |      0.933806 |         0.788235 |       0.442623 |        0.854868 |                        |                        |        1.7012987012987013 |        2.7916666666666665 |
| INDEL | PASS   |         423 |      395 |       28 |         915 |      108 |       405 |     4 |    13 |      0.933806 |         0.788235 |       0.442623 |        0.854868 |                        |                        |        1.7012987012987013 |        2.7916666666666665 |
| SNP   | ALL    |       20984 |    20600 |      384 |       26080 |      780 |      4703 |    62 |    10 |        0.9817 |         0.963512 |        0.18033 |        0.972521 |     3.0499710592321048 |     2.7596541786743516 |          1.58256372367935 |        1.8978207694018234 |
| SNP   | PASS   |       20984 |    20600 |      384 |       26080 |      780 |      4703 |    62 |    10 |        0.9817 |         0.963512 |        0.18033 |        0.972521 |     3.0499710592321048 |     2.7596541786743516 |          1.58256372367935 |        1.8978207694018234 |
**** DONE Test Twist Human core Exome (hg38):giab:
CLOSED: [2023-08-01 Tue 23:16] SCHEDULED: <202 3-08-02 Wed>
https://www.twistbioscience.com/resources/data-files/ngs-human-core-exome-panel-bed-file
#+begin_src
nextflow run workflows/compareVCF.nf -profile standard,helios --query=out/2300346867_63118093_NA12878-GRCh38/callVariant/haplotypecaller/2300346867_63118093_NA12878-GRCh38.vcf.gz --outdir=out/2300346867_63118093_NA12878-GRCh38/happy-twist-exome-core/ --compare=happy -lib lib --capture=capture/Twist_Exome_Core_Covered_Targets_hg38.bed  --id=HG001 --genome=GRCh38 -bg
#+end_src
| Type  | Filter | TRUTH.TOTAL | TRUTH.TP | TRUTH.FN | QUERY.TOTAL | QUERY.FP | QUERY.UNK | FP.gt | FP.al | METRIC.Recall | METRIC.Precision | METRIC.Frac_NA | METRIC.F1_Score | TRUTH.TOTAL.TiTv_ratio | QUERY.TOTAL.TiTv_ratio | TRUTH.TOTAL.het_hom_ratio | QUERY.TOTAL.het_hom_ratio |
| INDEL | ALL    |         328 |      313 |       15 |         722 |       95 |       309 |     4 |    13 |      0.954268 |         0.769976 |       0.427978 |        0.852273 |                        |                        |        1.8584070796460177 |        2.8967391304347827 |
| INDEL | PASS   |         328 |      313 |       15 |         722 |       95 |       309 |     4 |    13 |      0.954268 |         0.769976 |       0.427978 |        0.852273 |                        |                        |        1.8584070796460177 |        2.8967391304347827 |
| SNP   | ALL    |       19198 |    18962 |      236 |       23381 |      684 |      3738 |    48 |    10 |      0.987707 |         0.965178 |       0.159873 |        0.976313 |     3.1034188034188035 |      2.859264147830391 |        1.5669565217391304 |        1.8578767123287672 |
| SNP   | PASS   |

Replacement in projects/bisonex.org at line 70 [7.35]

B:BD[9.15676] → [9.15676:16641]

B:BD[9.16641] → [8.8241:8320]

B:BD[8.8320] → [12.16507:19472]

FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
@A00853:477:HMLWYDSX3:3:2114:14742:8860
CTTTTGCTTGTCCCCAGGACGCACCTCAGGGTGGTGAAGCAAAAAAACCACGGCCCAGGAGAGGGTGGGTGCTGTGGTCTCAGTGCCACCGATCAGGAGGTCCACTGCAGCCATGTGCAAGTGCCCTTCCAGGAGCTGTCCAGAGCCCTCT
+
FFFFFFFFFFFFFFFFFFFFFFF:FFF:FFFFFFFFFFFFF,FFFFFFFFFFFF:F:FFFF:FFFFF,,FFF:FFFFFFFFFF,FFFFFFF,FFFFFFFFFFF,FFFFFFFFF:FFFF,F:FFFFF:FFFFFFFFF:FFFF,FFFFFFFFF
******* DONE Supprimer NW_ et NT_
****** KILL Phase 2 : chr22, vaf variable :T2T:
CLOSED: [2023-08-12 Sat 15:59]
****** KILL Phase 3 : tous SNV, vaf variable :T2T:
CLOSED: [2023-08-12 Sat 15:59]
***** KILL Test Indel
CLOSED: [2023-08-12 Sat 15:59]
**** Divers
***** DONE Vérifier nombre de reads fastq - bam
CLOSED: [2022-10-09 Sun 22:31]
*** KILL Liste varants "clinically relevent" (Clinge - CT-R d)
CLOSED: [2023-06-25 Sun 15:53] SCHEDULED: <2023-06-25 Sun>
[cite:@wilcox2021
]
Vu avec alexis: pas notre cas d'usage
*** TODO Variant cento confirmé en S
anger :xamscissors:
**** DONE Générer la liste
CLOSED: [2023-08-13 Sun 22:26] SCHEDULED: <2023-08-13 Sun 12:00>
**** DONE 2 variants chr20 dans HG002 avec XAMscissors: homozygote
CLOSED: [2023-08-15 Tue 00:13] SCHEDULED: <2023-08-13 Sun 13:00>
***** DONE Insertion
CLOSED: [2023-08-13 Sun 23:31] SCHEDULED: <2023-08-13 Sun>
On récupère le BAM
#+begin_src sh :dir /home/alex/code/bisonex/out
scp /Work/Users/apraga/bisonex/out/HG002-151002_7001448_0359_AC7F6GANXX-GRCh38/preprocessing/mapped/HG002-151002_7001448_0359_AC7F6GANXX-GRCh38.bam
#+end_src
On formate les données et on génère les fastq
#+begin_src sh :dir /home/alex/roam/research/bisonex/code/sanger
julia --project=.. xamscissors.jl
#+end_src
On upload
#+begin_src sh :dir /home/alex/roam/research/bisonex/code/sanger
cd out
mv inserted_1.fq.gz HG002-sanger-inserted-chr20_1.fq.gz
mv inserted_2.fq.gz HG002-sanger-inserted-chr20_2.fq.gz
#+end_src
On upload
#+begin_src sh :dir /home/alex/roam/research/bisonex/code/sanger
scp HG002-sanger-inserted-chr20_*.fq.gz meso:/Work/Users/apraga/bisonex/data/
#+end_src
Fichier de configuration
patient,sample,fastq1,fastq2
HG002,sanger-chr20,data/HG002-sanger-inserted-chr20_1.fq.gz,data/HG002-sanger-inserted-chr20_2.fq.gz
On lance la simulation
#+begin_src
nextflow run main.nf -profile standard,helios --input=samples-synthetic.csv --genome=GRCh38  -bg
#+end_src
***** DONE Vérifier post alignement
CLOSED: [2023-08-13 Sun 23:44] SCHEDULED: <2023-08-13 Sun>
***** DONE Vérifier haplotypecaller
CLOSED: [2023-08-15 Tue 00:13] SCHEDULED: <2023-08-13 Sun>
***** DONE Vérifier post-filtre
CLOSED: [2023-08-15 Tue 00:13]
**** DONE 2 variant chr20 dans HG002 heterozygote
CLOSED: [2023-08-15 Tue 13:45] SCHEDULED: <2023-08-15 Tue>
La zygosité n'était pas correcte...
**** TODO [#B] Tout insérer dans NA12878 avec XAMscissors
SCHEDULED: <2023-08-14 Mon>
***** Insertion
On récupère le BAM
#+begin_src sh :dir /home/alex/code/bisonex/out
scp /Work/Users/apraga/bisonex/out/HG002-151002_7001448_0359_AC7F6GANXX-GRCh38/preprocessing/mapped/HG002-151002_7001448_0359_AC7F6GANXX-GRCh38.bam
#+end_src
#+begin_src sh :dir /home/alex/roam/research/bisonex/code/sanger
julia --project=.. xamscissors.jl
cd out-all
mv inserted_1.fq.gz HG002-sanger-inserted-_1.fq.gz
mv inserted_2.fq.gz HG002-sanger-inserted-_2.fq.gz
scp HG002-sanger-inserted-all_*.fq.gz meso:/Work/Users/apraga/bisonex/data/
#+end_src
Fichier de configuration
patient,sample,fastq1,fastq2
HG002,sanger-all,data/HG002-sanger-inserted-all_1.fq.gz,data/HG002-sanger-inserted-all_2.fq.gz
On lance la simulation
#+begin_src
nextflow run main.nf -profile standard,helios --input=samples-synthetic.csv --genome=GRCh38  -bg
#+end_src
**** TODO Données simuscop 200x
SCHEDULED: <2023-08-22 Tue>
* Résultats
** TODO Speed-up BWA-mem
SCHEDULED: <2023-08-26 Sat>
** TODO Speed-up Hapotypecaller
SCHEDULED: <2023-08-26 Sat>

[9.15676]

FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
@A00853:477:HMLWYDSX3:3:2114:14742:8860
CTTTTGCTTGTCCCCAGGACGCACCTCAGGGTGGTGAAGCAAAAAAACCACGGCCCAGGAGAGGGTGGGTGCTGTGGTCTCAGTGCCACCGATCAGGAGGTCCACTGCAGCCATGTGCAAGTGCCCTTCCAGGAGCTGTCCAGAGCCCTCT
+
FFFFFFFFFFFFFFFFFFFFFFF:FFF:FFFFFFFFFFFFF,FFFFFFFFFFFF:F:FFFF:FFFFF,,FFF:FFFFFFFFFF,FFFFFFF,FFFFFFFFFFF,FFFFFFFFF:FFFF,F:FFFFF:FFFFFFFFF:FFFF,FFFFFFFFF
******* DONE Supprimer NW_ et NT_
****** KILL Phase 2 : chr22, vaf variable :T2T:
CLOSED: [2023-08-12 Sat 15:59]
****** KILL Phase 3 : tous SNV, vaf variable :T2T:
CLOSED: [2023-08-12 Sat 15:59]
***** KILL Test Indel
CLOSED: [2023-08-12 Sat 15:59]
**** Divers
***** DONE Vérifier nombre de reads fastq - bam
CLOSED: [2022-10-09 Sun 22:31]
*** KILL Liste varants "clinically relevent" (Clinge - CT-R d)
CLOSED: [2023-06-25 Sun 15:53] SCHEDULED: <2023-06-25 Sun>
[cite:@wilcox2021]
Vu avec alexis: pas notre cas d'usage
*** TODO Variant cento confirmé en Sanger :xamscissors:
**** DONE Générer la liste
CLOSED: [2023-08-13 Sun 22:26] SCHEDULED: <2023-08-13 Sun 12:00>
**** DONE 2 variants chr20 dans HG002 avec XAMscissors: homozygote
CLOSED: [2023-08-15 Tue 00:13] SCHEDULED: <2023-08-13 Sun 13:00>
***** DONE Insertion
CLOSED: [2023-08-13 Sun 23:31] SCHEDULED: <2023-08-13 Sun>
On récupère le BAM
#+begin_src sh :dir /home/alex/code/bisonex/out
scp /Work/Users/apraga/bisonex/out/HG002-151002_7001448_0359_AC7F6GANXX-GRCh38/preprocessing/mapped/HG002-151002_7001448_0359_AC7F6GANXX-GRCh38.bam
#+end_src
On formate les données et on génère les fastq
#+begin_src sh :dir /home/alex/roam/research/bisonex/code/sanger
julia --project=.. xamscissors.jl
#+end_src
On upload
#+begin_src sh :dir /home/alex/roam/research/bisonex/code/sanger
cd out
mv inserted_1.fq.gz HG002-sanger-inserted-chr20_1.fq.gz
mv inserted_2.fq.gz HG002-sanger-inserted-chr20_2.fq.gz
#+end_src
On upload
#+begin_src sh :dir /home/alex/roam/research/bisonex/code/sanger
scp HG002-sanger-inserted-chr20_*.fq.gz meso:/Work/Users/apraga/bisonex/data/
#+end_src
Fichier de configuration
patient,sample,fastq1,fastq2
HG002,sanger-chr20,data/HG002-sanger-inserted-chr20_1.fq.gz,data/HG002-sanger-inserted-chr20_2.fq.gz
On lance la simulation
#+begin_src
nextflow run main.nf -profile standard,helios --input=samples-synthetic.csv --genome=GRCh38  -bg
#+end_src
***** DONE Vérifier post alignement
CLOSED: [2023-08-13 Sun 23:44] SCHEDULED: <2023-08-13 Sun>
***** DONE Vérifier haplotypecaller
CLOSED: [2023-08-15 Tue 00:13] SCHEDULED: <2023-08-13 Sun>
***** DONE Vérifier post-filtre
CLOSED: [2023-08-15 Tue 00:13]
**** DONE 2 variant chr20 dans HG002 heterozygote
CLOSED: [2023-08-15 Tue 13:45] SCHEDULED: <2023-08-15 Tue>
La zygosité n'était pas correcte...
**** KILL [#B] Tout insérer dans HG002 avec XAMscissors: erreur patient..
CLOSED: [2023-08-16 Wed 20:21] SCHEDULED: <2023-08-14 Mon>
***** DONE Insertion
CLOSED: [2023-08-16 Wed 20:21]
On récupère le BAM
#+begin_src sh :dir /home/alex/code/bisonex/out
scp /Work/Users/apraga/bisonex/out/HG002-151002_7001448_0359_AC7F6GANXX-GRCh38/preprocessing/mapped/HG002-151002_7001448_0359_AC7F6GANXX-GRCh38.bam
#+end_src
#+begin_src sh :dir /home/alex/roam/research/bisonex/code/sanger
julia --project=.. xamscissors.jl
cd out-all
mv inserted_1.fq.gz HG002-sanger-inserted-_1.fq.gz
mv inserted_2.fq.gz HG002-sanger-inserted-_2.fq.gz
scp HG002-sanger-inserted-all_*.fq.gz meso:/Work/Users/apraga/bisonex/data/
#+end_src
Fichier de configuration
patient,sample,fastq1,fastq2
HG002,sanger-all,data/HG002-sanger-inserted-all_1.fq.gz,data/HG002-sanger-inserted-all_2.fq.gz
On lance la simulation
#+begin_src
nextflow run main.nf -profile standard,helios --input=samples-synthetic.csv --genome=GRCh38  -bg
#+end_src
***** DONE Résultat après haplopecaller: 3 reads manquants mais logique
CLOSED: [2023-08-16 Wed 19:13]
Comparaison naive: Haplotypecaller 146 found over 149
Manquant:
 Row │ chrom    pos       ref      alt      zygosity  meanQual  stdQual  depth
     │ String7  Int64     String1  String1  String7   Float64   Float64  Int64
─────┼─────────────────────────────────────────────────────────────────────────
   1 │ chr12    13720138  C        T        het           60.0    NaN        1
   2 │ chr17    10296150  T        A        het           60.0      0.0      3
   3 │ chr21    43426167  C        T        het            0.0      0.0     88
   Donc pas assez de reads pour les 2 premiers et le dernier a des reads de mauvaise qualité (mais bien inséré).
   On est limité par le système d'un patient....
***** DONE Résultat après filter depth: 30 variants perdu mais logique
CLOSED: [2023-08-16 Wed 20:18] SCHEDULED: <2023-08-16 Wed>
On perd 30 variant
13×8 DataFrame
 Row │ chrom    pos        ref      alt      variant              meanQual  stdQual    depth
     │ String7  Int64      String1  String1  String               Float64   Float64    Int64
─────┼───────────────────────────────────────────────────────────────────────────────────────
   1 │ chr3      71112628  C        T        chr3:g.71112628C>T    60.0       0.0         62
   2 │ chr12     13720138  C        T        chr12:g.13720138C>T   60.0     NaN            1
   3 │ chr12     40367710  A        G        chr12:g.40367710A>G   59.3333    3.30289     45
   4 │ chr14     58458545  G        A        chr14:g.58458545G>A   60.0       0.0          9
   5 │ chr15     66703292  C        T        chr15:g.66703292C>T   60.0       0.0         33
   6 │ chr16     30965737  C        A        chr16:g.30965737C>A   60.0       0.0         18
   7 │ chr17     10296150  T        A        chr17:g.10296150T>A   60.0       0.0          3
   8 │ chr17     61968202  A        C        chr17:g.61968202A>C   60.0       0.0         46
   9 │ chr21     43426167  C        T        chr21:g.43426167C>T    0.0       0.0         88
  10 │ chrX     124056226  T        G        chrX:g.124056226T>G   60.0       0.0         40
  11 │ chrX      24737739  G        T        chrX:g.24737739G>T    60.0       0.0         16
  12 │ chrX      40591349  C        T        chrX:g.40591349C>T    60.0       0.0         37
  13 │ chrX      53193275  G        A        chrX:g.53193275G>A    60.0       0.0         32
 Le filtre est sur DP (read depth) et non la profondeur. Sur 1 et 3, DP=29 et 28...
 Si on est hétérozygote, le DP est la moitié de la profondeur donc c'est logique...
***** DONE Résultat après filter polymorphism : idem
CLOSED: [2023-08-16 Wed 20:18]
***** Résultat après filtre VEP
**** TODO [#B] Tout insérer dans NA12878 avec XAMscissors
SCHEDULED: <2023-08-14 Mon>
***** TODO Insertion
On récupère le BAM
#+begin_src sh :dir /home/alex/code/bisonex/out
rsync -avz  meso:/Work/Users/apraga/bisonex/out/2300346867_NA12878-63118093_S260-GRCh38/preprocessing/mapped 2300346867_NA12878-63118093_S260-GRCh38/preprocessing/
#+end_src
#+begin_src sh :dir /home/alex/roam/research/bisonex/code/sanger
julia --project=.. xamscissors.jl
cd out-all
mv inserted_1.fq.gz NA12878-sanger-inserted-all_1.fq.gz
mv inserted_2.fq.gz NA12878-sanger-inserted-all_2.fq.gz
rsync -avz NA12878-sanger-inserted_* meso:/Work/Users/apraga/bisonex/data/
#+end_src
Fichier de configuration
patient,sample,fastq1,fastq2
NA12878,sanger-all,data/NA12878-sanger-inserted-all_1.fq.gz,data/NA12878-sanger-inserted-all_2.fq.gz
On lance la simulation
#+begin_src
nextflow run main.nf -profile standard,helios --input=samples-synthetic.csv --genome=GRCh38  -bg
#+end_src
***** TODO Résultat après haplotyecaller
***** TODO Résultat après filtre depth
***** TODO Résultat après filtre common variant
***** TODO Résultat après filtre VEP
**** TODO Données simuscop 200x
SCHEDULED: <2023-08-22 Tue>
* Résultats
** TODO Speed-up BWA-mem
SCHEDULED: <2023-08-26 Sat>
** TODO Speed-up Hapotypecaller
SCHEDULED: <2023-08-26 Sat>